toward a single scheme for both civil servants and private employees

... continual androgen ablation The fact that continual androgen ablation had an average increase of 114% in tumor volume means that using T alone after androgen ablation was only a little worse than ... Harada N, Tozawa K, Yamada Y, Hayashi Y, Tanaka S, Maruyama K, Kohri K: Aromatase mRNA Levels in Benign Prostatic Hyperplasia and Prostate Cancer Int J Urol 1996, 3:292-296 Matthews J, Gustafsson J-Å: ... Kogia C, Charalampopoulos I, Theodoropoulos PA, Anezinis P, Dambaki C, Papakonstanti EA, Stathopoulos EN, Stournaras C, Gravanis A, Castanas E: Membrane Androgen Receptor Activation Induces Apoptotic...

Ngày tải lên: 13/08/2014, 16:21

... in both fatal and nonfatal firearm use can lead toward the fact-based formation of policy and gun regulation Upon gathering this information and analyzing the data, it may be found that different ... identification, 911 calls, and hospital reporting are all methods for crime reporting The shooting database will allow for validation of data sources on shooting incidents and inform future database ... disadvantage/code of the street and shootings Race/Ethnicity and shootings Gang areas and shooting Drug areas and shootings Categorization of shootings Method of shootings 10 Firearm type and...

Ngày tải lên: 23/03/2014, 12:20

... glutathione-Sepharose and low-molecular-mass markers, from Amersham Pharmacia Biotech (Uppsala, Sweden) Talon metal affinity resin was obtained from Clontech Laboratories Inc (Palo Alto, CA, USA) ... bacterial two-hybrid system We also thank Mr T Kobayakawa (Nagasaki University, Nagasaki, Japan) for the technical assistance This work was supported by Grants-in-Aid for Scientific Research from ... domain and the C-terminal domain Similarly, the C-terminal 326 amino acids of barley GRP94 [22] and 200 amino acids of canine GRP94 [27] are sufficient for the dimer formation However, Wearsch and...

Ngày tải lên: 23/03/2014, 20:22

... EURASIP Journal on Wireless Communications and Networking Analytical Approach on the AWPP Operation This paper presents both an analytical and a simulation approach on the operation of the AWPP protocol ... It can be seen that regarding MP traffic, performance degradation starts at significantly lower load in POAP than in AWPP HCCA exhibits a steady behavior to a limited load, as it is already explained ... STA A (i) Polling a Station That Has No Packets for Transmission (Figure 1 (a) ) The AP polls a station and the latter responds that it has no packets for transmission (ii) Polling a Station That...

Ngày tải lên: 21/06/2014, 05:20

... looks as an artificial transformation, and a more natural password” would be specified as the arithmetic average of integers that form the block However, the arithmetic average is a float, and we also ... compression factor is equal to Tn/T = n and the false acceptance rate is equal to 2−T , that is, the scheme has a similar features as our scheme However, to attain a large EURASIP Journal on Information ... Balakirsky, A R Ghazaryan, and A J Han Vinck, “Combinatorial data reduction algorithm and its applications to biometric verification,” in Proceedings of the IEEE International Symposium on Information...

Ngày tải lên: 21/06/2014, 11:20

... Speed-Adaptive Media-Data Encryption (SAME) Statistical characteristics of compressed audio/video data are dramatically different from the ones of text data, because the variable-length codes and ... the redundant information from the EURASIP Journal on Wireless Communications and Networking original data Statistical analysis in [12] shows that the coded data have high randomness at the byte ... level Based on this statistical characteristic of media data, we extend the idea of VEA algorithm to a new method that uses traditional block cipher to encrypt a part of data (part I), and uses...

Ngày tải lên: 21/06/2014, 11:20

... Search, Optimization and Machine Learning, Addison-Wesley, Reading, Mass, USA, 1989 [19] T Trappenberg, J Ouyang, and A Back, “Input variable selection: mutual information and linear mixing measures,” ... theory provides a suitable formalism for quantifying these concepts Assume a random variable X representing continuousvalued random feature vector, and a discrete-valued random variable C representing ... the data is applied that maximizes the mutual information between the transformed features and the class labels Finding the linear mapping was performed using standard gradient descent-ascent...

Ngày tải lên: 21/06/2014, 22:20

... On a higher order neutral difference equation, Mathematical Analysis and Applications (Th M Rassias, ed.), Hadronic Press, Florida, 2000, pp 37–64 [5] X Z He, Oscillatory and asymptotic behaviour ... nonlinear difference equation, Journal of the Australian Mathematical Society Series A 67 (1999), no 1, 122–142 [8] X Tang and J Yan, Oscillation and nonoscillation of an odd-order nonlinear neutral ... order nonlinear difference equations, Journal of Mathematical Analysis and Applications 175 (1993), no 2, 482–498 [6] B S Lalli, Oscillation theorems for neutral difference equations Advances in difference...

Ngày tải lên: 22/06/2014, 22:20

... 16 (page number not for citation purposes) Retrovirology 2008, 5:77 GATTTTTAAGGTATTC (5' MLU) and either 5'-CGAGATATTATAACAGATGTTATTAGCACAT-3' (ENV 7076) or 5' GGTCTTGAATCTGTGAAGTGTACCACATA (ENV ... by amplifying the SU coding sequence with the oligonucleotide primers 5'-CGATCTAGAAACAATAATTATGGCAGAAG-3' and 5'-GGCGGCCGCTGGTACCAC(C/T)AAGTAATC-3' corresponding to the start codon for Env leader ... [37-42] Accordingly, the FL4 cell line has provided the basis for the first commercially available FIV vaccine (Fel-O-Vax FIV, Fort Dodge), approved for use in the USA, Japan, New Zealand and Australia...

Ngày tải lên: 13/08/2014, 05:21

... telemanipulators have already been employed in rehabilitation and secure a greater and sooner impact on the life of many impaired persons However, an important drawback for such applications lays in that, ... natural variations “Engineering” simplified models, for qualitative analysis, have also appeared [31] Although models of arm impedance, based on only the measured “macroscopic” variables (arm force ... local master variables This way the “feel” of teleoperation is natural and human-friendly, since the variables are simultaneous, and also not altered by the algorithm, as in existing approaches...

Ngày tải lên: 26/10/2014, 14:31

Ngày tải lên: 14/11/2014, 07:24

... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... drawer may prohibit presentment for acceptance He may al so stipulate that presentment for acceptance 75 shall not take place before a named date Unless the drawer has prohibited acceptance, every ... to act The same rule applies to a representative who has exceeded his powers Article The drawer guarantees both acceptance and payment 33 34 He may release himself from guaranteeing acceptanceevery...

Ngày tải lên: 22/10/2013, 10:15

... the ®rms of that society are organized and interconnected All capitalist societies will have state apparatuses and private ®rms, and among private ®rms some will be small and some large The size ... ``weak'' class formations; unitary or fragmented class formations; revolutionary, counterrevolutionary or reformist class formations Typically, class formations involve creating formal organizations ... working-class or capitalist-class interests Limitation, selection and transformation In elaborating a micro-model of class consciousness and a macro-model of class formation we will describe the causal...

Ngày tải lên: 01/11/2013, 07:20

... Miroslav Melichar, and Martin Rajman 2005 A Framework for Rapid Multimodal Application Design In V´ clav Matouˇek, Pavel Mautner, a s and Tom´ s Pavelka, editors, Proceedings of the 8th a International ... environment and experimental protocol) has now reached a stable stage that allows for the elicitation of sufficient amounts of natural language and interaction data The next step will be to run a large-scale ... graphical, textual and vocal feedback tions compared to others, language use must be encouraged without being forced, and finding this balance can be very hard to achieve in practice Design and...

Ngày tải lên: 20/02/2014, 12:20

... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... 2007 The Authors Journal compilation ª 2007 FEBS N Zaidi et al Parallel detection of CatE and CatD activity TAPA and specific catalytic activities of CatE and CatD were determined fluorimetrically ... PCR buffer (Roche, Basel, Switzerland), 3.3% (v ⁄ v) both primers (5¢-CATGATGGAATTACGTT-3¢ and 5¢-GA ATGATCCAGGTACAGCAT-3¢) 10 lm each (Operon Technologies Alameda, CA, USA), 2.2% (v ⁄ v) dNTP...

Ngày tải lên: 07/03/2014, 09:20

... Collect a water sample for bacterial analysis Standards s Know when to take a sample for bacteriological analysis and understand the importance of sample timing The current standards for judging ... Spas and hot tubs have greater water balancing demands than larger pools because of higher water temperatures and bather loads Under-saturated water is aggressive and has corrosive action against ... management and pesticide handling information for persons managing bacteria, fungi, algae or viruses in swimming pools, hot tubs, and spas and wading pools This manual is self-teaching and contains learning...

Ngày tải lên: 11/03/2014, 17:20

... morphological attribute (i.e., case) The variables L3,6 , CASE3,acc and CASE6,acc are bolded, indicating that w3 and w6 are linked and both have the accusative case The ternary factor CASE-LINK, that connects ... morphologi- cal attributes such as “plural” or “past tense” Cohen and Smith (2007) separately train a discriminative conditional random field (CRF) for segmentation and tagging, and a generative probabilistic ... scenario, where an accusative adjective was tagged as nominative, and was then misanalyzed by the parser as modifying a verb (as a subject) rather than modifying an accusative noun For participles...

Ngày tải lên: 17/03/2014, 00:20

... this paper, we describe a bilingual concordance designed as a computer assisted translation and language learning tool Currently, TotalRecall uses Sinorama Magazine corpus as the translation ... and Ministry of Education, Taiwan (NSC 90-2411-H-007-033MC and MOE EX-91-E-FA06-4-4) and a special grant for preparing the Sinorama Corpus for distribution by the Association for Computational ... database with newer information from Sinorama magazine so that the concordance is kept current and relevant to the To make these up to date and relevant The bilingual texts that go into TotalRecall...

Ngày tải lên: 17/03/2014, 06:20

... attitudes and behaviors Originally designed in Uganda in 1995, and now expanded beyond Africa to Asia, Latin America and the Caribbean, and Eastern Europe, Stepping Stones is a participatory gender-focused ... illustrate programs that were first designed to work with men and boys, and then expanded their organizational mandate to incorporate women and girls Program H in Brazil The Program H Alliance, an affiliation ... and change rigid gender norms and imbalance of power as a means of reaching health as well as genderequity objectives Gender-transformative approaches encourage critical awareness among men and...

Ngày tải lên: 28/03/2014, 14:20

... Technology, and Gianni Zappalà and Lisa Waldron from the Westpac Foundation for their encouragement and for providing an opportunity for Jenny and Rhyall to present a draft version at the joint QUT and ... social accounting, but what is it? and how can it be applied to community organisations and enterprises? Unfortunately, not a lot of information is readily-available on social accounting in the Australian ... tools that “get at” the most important information (i.e information that relates to values, aims and objectives) design tools that are easy to use and collate design tools that are appropriate to...

Ngày tải lên: 29/03/2014, 20:20