... correlation was assessed as the ratio of the variance component to its standard error evaluated against a t-distribution An approximate a priori average standard error of 0.1 was estimated from ... strong correlations between many traits and body weight and CK in the full data set that are weak and non-significant in the traditional and layer lines There are also several strong correlations ... correlations between shear force and plasma ion concentrations in L and T lines whereas the relationships were negative and significant for Na+, total and free Ca++ High plasma ion concentrations...
... immunological analysis on days and 15, and 20 days after each immunization Challenge and parasitemia assessment Both immunized and control A nancymaae monkeys were infected with 200 000 P falciparum ... polymers were analysed by size-exclusion chromatography; their molecular masses ranged from to 24 kDa against experimental challenge with the P falciparum malaria parasite Spleen-intact Aotus monkeys, ... calculations were repeated several times until a structure having a minimum of distance and angle restraint violations and the least root mean square deviation (RMSD), respecting consensus least...
... RA duration was done because the chance for a patient to be treated with more than one DMARD increases the longer the duration of the disease As an additional analysis prednisone use ever was ... infarction, a coronary artery by-pass graft procedure, a percutaneous transluminal coronary angioplasty or ischemic abnormalities on ECG Cerebral arterial disease was defined as a history of cerebral vascular ... vascular accident (confirmed by a neurologist), a transient ischemic attack or a carotid endarterectomy Peripheral arterial disease included an aneurysm of the thoracic and/or abdominalis aorta, a...
... drugs, antiplatelet agents, and anticoagulants Am J Gastroenterol 2007, 102:507-515 Lanas A, Garcia-Rodriguez LA, Arroyo MT, Gomollon F, Feu F, Gonzalez-Perez A, Zapata E, Bastida G, Rodrigo L, Santolaria ... of the univariate or multivariate analyses Table Multivariate analysis of significant variables and other likely causational variables for serious NSAID ulcer complications Predictor Adjusted OR ... questionnaires or during verification All non-responders were sent a second identical questionnaire Finally, a random sample of non-responders was telephoned to detect bias in non-responding Statistical...
... Y, Kosaki A, Kishimoto N, Kimura T, Iida K, Fukui M, Nakajima F, Nagahara M, Urakami M, Iwasaka T, Matsubara H: Increased plasma S10 0A1 2 (EN-RAGE) levels in hemodialysis patients with atherosclerosis ... Kosaki A, Hasegawa T, Kimura T, Iida K, Hitomi J, Matsubara H, Mori Y, Okigaki M, Toyoda N, Masaki H, Inoue-Shibata M, Nishikawa M, Iwasaka T: Increased plasma S10 0A1 2 (ENRAGE) levels in patients ... in conception, design, acquisition, analysis and interpretation of data WY and CG carried out S10 0A8 , S10 0A9 and S0 0A1 2 assays YC, CG, MB and RT wrote the manuscript All authors read and approved...
... of all participant cases and matched controls) All cases fulfilled the American College of Rheumatology 1987 criteria for the classification of RA All participants gave informed consent and answered ... The participation rate was high, and detailed information about smoking status and validated genetic risk factors was available The findings were then replicated in another independent Caucasian ... standard procedures and ACPAs by standard ELISA (Immunoscan-RA Mark2 ELISA test; Euro-Diagnostica, Malmö, Sweden) RF status was missing for 9%, and ACPA status was not available for 6% The methods...
... the validation of this equation in different patient populations We acknowledge that this equation is only a substitute for the actual glomerular filtration rate, but validation of this equation ... on admission and at the time of maximum RIFLE class, APACHE III score, SOFA score and the nonrenal SOFA score, and the proportion of patients already admitted inhospital to another non-ICU ward ... performed automated and manual data verification The patient data included demographic, administrative, physiologic, laboratory and hospital outcome information Ethnicity, reported as white, black...
... Belyatskaya OYa (1980) Modifying effect of extremal temperature depending on the organism adaptation to this factor on the action of radiation I Characterization of a Drosophila stock adapted to ... N’Djamena (Chad, Central Africa) that were subjected to artificial selection for increased heat tolerance (Tikhomirova and Belyatskaya, 1980) Flies of the T-32 strain are exceptional in that they ... subtelomeric repeat designated Dm665 (Danilevskaya et al, 1984) Parallel hybridizations with Dm665 and A1 7 probes were performed on salivary from the same larva More intense hybridizations of the same telomeres...
... observations of national probability samples of programs, families, and children Dr Zill has been a senior technical adviser and lead analyst for the National Head Start Impact Study, a random-assignment ... Technical Planning Group on School Readiness for the National Education Goals Panel, and developed a child health index that the Goals Panel reported annually for each state and the nation as a whole ... with large black populations, such as Mississippi, Arkansas, Alabama, and Louisiana, less than half of all children live with both parents (Nowadays, 70 percent of black children nationwide are...
... Wanless, and P Rothery 2000 Adult survival rates of shag Phalacrocorax aristotelis, common guillemot Uria aalge, razorbill Alca torda, puffin Fratercula arctica and kittiwake Rissa tridactyla on ... years and senescent years in relation to general weather conditions experienced early in life (average early-life winter North Atlantic Oscillation [wNAO]) Average early-life wNAO was fitted as ... Hamilton 1966; Charlesworth 1980; Partridge and Barton 1993) In the mutation accumulation theory for the evolution of aging, harmful mutations with late-acting effects amass in older age classes...
... to have an impact on an individual basis Strengths and limitations Our data were collected as part of a big nationwide sample which was assessed with a personal interview face to face, acomprehensive ... patients with seasonal and non seasonal depression Psychiatry Res 2004, 128:245-251 Michalak E, Tam E, Manjunath CV, Levitt AJ, Levitan RD, Lam RW: Quality of life in patients with seasonal affective ... Questionnaire Psychol Med 1979, 9:139-145 Montazeri A, Mahmood A, Shariati M, Garmaroudi G, Ebadi M, Fateh A: The 12-item General health Questionnaire (GHQ-12) translation and validation study...
... TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches ... Nicholas KB, Nicholas HB, Deerfield DW: GeneDoc: analysis and visualization of genetic variation Embnet News 1997, 4:14 Okada J, Urasawa T, Kobayashi N, Taniguchi K, Hasegawa A, Mise K, Urasawa S: ... 199:233-237 Iturriza-Gomara M, Kang G, Mammen A, Jana AK, Abraham M, Desselberger U, Brown D, Gray J: Characterization of G10P[11] rotaviruses causing acute gastroenteritis in neonates and infants in Vellore,...
... preparation RZ contributed to study design, MRI data acquisition, data interpretation and manuscript preparation EC contributed to MRI data acquisition AD contributed to clinical data acquisition ... contributed to clinical data acquisition BT oversaw clinical data acquisition SH contributed to data acquisition BM contributed to clinical data acquisition MW contributed to clinical data acquisition ... acquisition JD contributed to MRI data acquisition NB contributed to MRI data acquisition MR contributed to study design, data analysis and interpretation and manuscript preparation Al authors read and...
... particle-enhanced immunturbidimetric assay, using an automated laboratory analyzer (Roche Cobas Integra 400, Basel, Switzerland) Statistical evaluation of the results Statistical analysis was performed ... ficolin-3 and C-reactive protein in the sera of patients with acute ischemic stroke Concentrations at the time of hospital admission and on day 3, as compared to healthy controls (HC) and patient controls ... [34] Additionally, a strong negative correlation was found between ficolin-3 concentration and the outcome of the disease measured with modified Rankin scale This negative correlation indicates...
... 1997, 142:1881-1887 Taniguchi K, Wakasugi F, Pongsuwanna Y, Urasawa T, Ukae S, Chiba S, Urasawa S: Identification of human and bovine rotavirus serotypes by polymerase chain reaction Epidemiol Infect ... 2001:1747-1785 Martella V, Ciarlet M, Baselga R, Arista S, Elia G, Lorusso E, Banyai K, Terio V, Madio A, Ruggeri FM, Falcone E, Camero M, Decaro N, Buonavoglia C: Sequence analysis of the VP7 and VP4 ... Elia G, Arista S, Camero M, Desario C, Decaro N, Lavazza A, Buonavoglia C: Identification of a novel VP4 genotype carried by a serotype G5 porcine rotavirus strain Virology 2005:Dec 16 (Epub ahead...
... TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches ... Nicholas KB, Nicholas HB, Deerfield DW: GeneDoc: analysis and visualization of genetic variation Embnet News 1997, 4:14 Okada J, Urasawa T, Kobayashi N, Taniguchi K, Hasegawa A, Mise K, Urasawa S: ... 199:233-237 Iturriza-Gomara M, Kang G, Mammen A, Jana AK, Abraham M, Desselberger U, Brown D, Gray J: Characterization of G10P[11] rotaviruses causing acute gastroenteritis in neonates and infants in Vellore,...
... DM, Nijaguna MB, Sridevi S, Vrinda M, Arivazhagan A, Balasubramaniam A, Hegde AS, Chandramouli BA, Santosh V, Rao MR, Kondaiah P, Somasundaram K: Identification of potential serum biomarkers ... serous ovarian cancer patients when compared to controls and that, at least in one instance, decreased levels of GPX3 may provide additional diagnostic information beyond CA125 Abbreviations CA125: ... over-expression of glutathione peroxidase in clear cell type ovarian adenocarcinoma Med Oncol 2010 25 Saga Y, Ohwada M, Suzuki M, Konno R, Kigawa J, Ueno S, Mano H: Glutathione peroxidase is a candidate...
... University of Zambia Research Ethics Committee (Lusaka, Zambia), and the Page of Institutional Review Boards at the University of Alabama at Birmingham (Birmingham, Alabama, USA) and Vanderbilt University ... chronic inflammation Albumin is a negative acutephase reactant, and albumin synthesis, degradation and leakage from the vascular compartment are cytokinemediated processes [8,30] Some data suggest ... Trabattoni D, Saresella M, Piconi S, Lukwiya M, Declich S, Fabiani M, Ferrante P, Clerici M: Immune activation in HIV-infected African individuals Italian-Ugandan AIDS cooperation program AIDS...