toward a class based constitutionalism of collectivities
Tài liệu Báo cáo khoa học: "Topological Dependency Trees: A Constraint-Based Account of Linear Precedence" ppt
... an auxiliary flip involving a substitute infinitive is called an ‘obligatory auxiliary flip’ (18) (dass) Maria einen Mann hat lieben k¨ nnen o (that) Maria a man has love can (that) Maria was able ... and Nakazawa, 1994), the verbal complement of an auxiliary verb, such as haben or werden, follows rather than precedes its head Only a certain class of bare infinitive verbs can land in extraposed ... Maria a man love can will (that) Maria will be able to love a man subjec vc n (dass) Maria einen Mann lieben k¨ nnen wird o Optional Auxiliary Flip In an auxiliary flip construction (Hinrichs and...
- 8
- 353
- 0
Báo cáo khoa học: "A Class-Based Agreement Model for Generating Accurately Inflected Translations" pptx
... ACL N Habash and F Sadat 2006 Arabic preprocessing schemes for statistical machine translation In NAACL H Hassan, K Sima’an, and A Way 2007 Supertagged phrasebased statistical machine translation ... Better Arabic parsing: baselines, evaluations, and analysis In COLING N Habash and O Rambow 2005 Arabic tokenization, part-ofspeech tagging and morphological disambiguation in one fell swoop In ACL ... The alignment template approach to statistical machine translation Computational Linguistics, 30(4):417–449 F J Och, D Gildea, S Khudanpur, A Sarkar, K Yamada, A Fraser, et al 2004 A smorgasbord...
- 10
- 414
- 0
Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx
... has developed a prototype parser for a fragment of a GB grammar [9] The system consists of a declarative specification of the GB model, which incorporates the various principles of grammar and ... note that, for phrase structure at least, the relevant principles of grammar can be stated purely as conditions on branches, rather that trees More generally, We will assume the schema of a particular ... particular representation provides a formal characterisation of locality Just as phrase structure is defined in terms of branches, we can define Chains as a sequence of links More specifically, each...
- 6
- 364
- 0
A Perception-Based View of the Employee: A Study of Employees’ Reactions to Change doc
... consequences of organizational change However, it can also be reasoned that the consequences of organizational change are part of change efforts and thus cannot be clearly separated As discussed above, a ... probable that resistance to change may at times have a positive effect on the outcome of organizational change, and that it may be strategically valuable to an organization For example, it is imaginable ... rationality—seem to have conditioned both the theoretical and empirical research in organizational change and employees’ reactions to Organizational change can be considered as a class of organization...
- 249
- 378
- 0
Báo cáo khoa học: "Toward a Plan-Based Understanding Model for Mixed-Initiative Dialogues" pptx
... stack depends upon which domain plan schemata are available in a speaker's domain plan library, we assume that a rational agent would have a schema containing the plan to attend a conference, A ... data: 1) an extraction from a Japanese dialogue in the conference registration domain, and 2) an extraction from a Spanish dialogue in the travel agency domain SpA and SpB refer to Speaker A and ... understanding [Litman and Allen, 1987] assumes a single plan library that contains the domain plans of the two speakers, and a shared plan stack mechanism to track the current plan structure of the...
- 8
- 253
- 0
A Risk-based Audit of the Captive/Privately- owned Cervid Industry in Michigan pot
... Laboratory AIA Animal Industry Act AID Animal Industry Division, Michigan Department of Agriculture APHIS-VS Animal and Plant Health Inspection Service, Veterinary Services APHIS-WS Animal and ... specifically the State Veterinarian, was granted regulatory authority over the health and welfare of domestic animals in the Animal Industry Act (AIA), P .A 466 of 1988 (AIA 1988) The AIA was “intended ... contamination via the manure or carcasses of infected animals This audit was able to gather some of the first information on the ways that C/P -OC facilities manage and dispose of these materials...
- 168
- 282
- 1
Báo cáo khoa học: "A CLASS-BASED APPROACH TO LEXICAL DISCOVERY" pdf
... scope of WordNet that were tagged as classification in the WordNet hierarchy, and to classify nouns proper names were mapped to the token pname, a subclass of on the basis of their feature-value ... a way that alternations such as the causative/inchoative alternation (e.g 2 (a, b)) are learned using class information about the observed subjects and objects of the verb, in addition to subcategorization ... Coherent Classes A search among a verb's object nouns requires at most I .A/ " computations of the association score, and I can thus be done exhaustively An exhaustive search among object classes...
- 3
- 207
- 0
functional discourse grammar a typologically-based theory of language structure sep 2008
... person attr attributive third person aug augmentative a actor aux auxiliary abil ability av actor voice abl ablative avol avolitional abs absolutive ben benefactive acc accusative caus causative acq ... bananas ’ “ then Jafa carried the basket and went upwards Went upwards he picked the bananas ” In many Indo-Pacific languages there are several grammatical phenomena that are a faithful and ... the idea of a Functional Discourse Grammar At the time it was conceived of as a revised version of Functional Grammar (FG; Dik 199 7a, 1997b), a theory of the organization of natural languages developed...
- 528
- 624
- 0
báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx
... with a standardized list of reasons to choose from, and health literacy may have affected the accuracy of these data Our study was cross-sectional in nature and does not allow for proper evaluation ... forms of major depression and childhood trauma Proc Natl Acad Sci USA 2003, 100:14293-14296 Furu K, Straume B: Use of antiacids in a general population: the impact of health-related variables, ... Sedatives - Benzodiazepines Antidepressants Asthma medications Anti-histamines Cold/sinus Anti-migraine Anti-allergy Pain relievers (includes NSAIDs and narcotics) - Narcotic pain relievers - Acetaminophen...
- 11
- 512
- 0
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf
... lopinavir, atazanavir, or fosamprenavir) Statistical Analysis The first analysis evaluated participant characteristics associated with initiation of HAART Baseline variables were measured within ... briefly characterize the determinants of access to HAART and to assess late vs early initiation of HAART in a population -based cohort of HIV-positive Argentinean men and women Methods PUMA is an ongoing ... associated with HAART initiation AIDS-defining illness and viral load were also associated with time to initiation of and late access to HAART As expected, those who started HAART in this study had...
- 7
- 398
- 0
báo cáo hóa học:" Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" doc
... with a standardized list of reasons to choose from, and health literacy may have affected the accuracy of these data Our study was cross-sectional in nature and does not allow for proper evaluation ... forms of major depression and childhood trauma Proc Natl Acad Sci USA 2003, 100:14293-14296 Furu K, Straume B: Use of antiacids in a general population: the impact of health-related variables, ... Sedatives - Benzodiazepines Antidepressants Asthma medications Anti-histamines Cold/sinus Anti-migraine Anti-allergy Pain relievers (includes NSAIDs and narcotics) - Narcotic pain relievers - Acetaminophen...
- 11
- 498
- 0
Báo cáo hóa học: " Research Article A WiMAX-Based Implementation of Network MIMO for Indoor Wireless Systems" pptx
... channel state information is instantaneously and perfectly available at each AP and user Also, ideal Shannon-rate coding has been assumed, that is, the impact of real-world coding and modulation ... the floor of the network area and shadow fading realizations for the links to all the APs We assign a user to the AP with maximum average SNR, accounting for distancebased path loss and shadowing ... equal-duration guard intervals (approximately EURASIP Journal on Advances in Signal Processing 10 m 10 m AP AP AP AP AP AP AP AP Figure 2: Indoor system model depicting APs serving users Lines indicate...
- 11
- 398
- 0
Báo cáo toán học: "A duality based proof of the Combinatorial Nullstellensatz Omran Kouba" pps
... Combinatorial Nullstellensatz Recent trends in combinatorics (M´traa h´za, 1995) Combin Probab Comput (1999), 7–29 a [2] Shirazi, H and Verstra¨te, J., A note on polynomials and f -factors of graphs ... defines an element from (Km [T ])∗ and, consequently, it has a unique expression as a linear combination of the elements of the basis (µt )t∈S This proves the existence of a familly of scalars (λS ... such that t S ϕm (P ) = t∈S λt µt (P ) for any polynomial P in Km [T ], and achieves the proof of Lemma Before proceeding with the proof of Theorem 1, let us recall that the total degree of a polynomial...
- 3
- 266
- 0
báo cáo khoa học: " Which factors explain variation in intention to disclose a diagnosis of dementia? A theory-based survey of mental health professionals" pot
... literature review, interviews with people with dementia and caregivers, and a consensus panel including a range of professionals and a patient advocate We judged that, based on likely length, a ... first draft of the manuscript and all authors participated in subsequent revisions All authors read and approved the final manuscript 10 11 12 13 Department of Health: National Service Framework ... Implementation Science 2007, 2:31 Background The early care of people with dementia ideally involves a sensitive and accurate explanation of the diagnosis to individuals and informal carer-givers, and...
- 10
- 225
- 0
báo cáo khoa học: " Which factors explain variation in intention to disclose a diagnosis of dementia? A theory-based survey of mental health professionals" potx
... literature review, interviews with people with dementia and caregivers, and a consensus panel including a range of professionals and a patient advocate We judged that, based on likely length, a ... first draft of the manuscript and all authors participated in subsequent revisions All authors read and approved the final manuscript 10 11 12 13 Department of Health: National Service Framework ... Implementation Science 2007, 2:31 Background The early care of people with dementia ideally involves a sensitive and accurate explanation of the diagnosis to individuals and informal carer-givers, and...
- 10
- 557
- 0
Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf
... used AGGAAAAGGCCTTGAAGCTC and TGCTGTATTTGACAGGACAAGTG (outer primers), and GAGGACATGCTCCTACCTGTG and TGCTGTATTTGACAGGACAAGTG (inner primers) For CN272097 we used CCAACGTGAGCTTCCAGAAC and ACAGAAACGCCTCTTCTCATTTAG ... Organ site Brain Breast Breast Breast cancer adenocarcinoma (metastasis pleural effusion) Prostate metastasis Ovarian carcinoma Ductal carcinoma Breast cancer adenocarcinoma (metastasis pleural ... paper All authors read and approved the final manuscript 10 Additional data files The following additional data are available with the online version of this paper Additional data file contains...
- 17
- 424
- 0
a corpus-based analysis of the collocates of the word homeland in the 1990s, 2000s and 2010s = nghiên cứu đồng định vị của từ homeland qua các thập niên 1990, 2000 và 2010 trên cơ sở ngôn ngữ học khối liệu
... quantitative and qualitative analytical techniques Corpus linguistics and Discourse analysis Corpus -based approach is found to be of great value since it can be applied to a number of areas of ... use of a language feature, for example, analyzing the factors that affect the omission or retention of that in complement clauses; examining the realizations of a particular function of language, ... corpus -based analysis of the collocates of the word “homeland” The data for the analysis were taken from two popular corpora which are Corpus of Contemporary American English and Time Magazine...
- 40
- 433
- 0
A student - based evaluation of the reading comprehension tasks in Tieng Anh 12 Nang Cao = Đánh giá của học sinh về các hoạt động đọc hiểu trong sách
... legitimate way of carrying out an empirical evaluation of teaching materials A micro-evaluation of teaching materials is perhaps best carried out in relation to task (Ellis, 1997: 37) Tasks within ... postmethod pedagogy has to be a pedagogy of particularity That is to say, language pedagogy, to be relevant, must be sensitive to a particular group of teachers teaching a particular group of learners ... VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST-GRADUATE STUDIES V TH KIM THANH A STUDENT- BASED EVALUATION OF THE READING COMPREHENSION TASKS...
- 63
- 911
- 0
LUẬN VĂN TỐT NGHIỆP A SYSTEM BASED THEORY OF ORGANIZZTIONAL INFORMATION
... afford to explain simultaneously both the nature of organizational information and the process of organizational information creation in the same model We are unaware of any literature that approaches ... conceptualization of organizational information could make a firmly theoretical foundation for some theories of organization Practically, the examination could explain various phenomena of organization ... research was a theorizing endeavor for a systems based theory of organizational information In essence, it is a conceptualization of the phenomena of organizational information in terms of the nature...
- 400
- 390
- 0
Designing a task based syllabus of english for electrical engineering at industrial university of vinh
... understand the task and what they are doing, and not act in a mechanical way Richards (2001) holds that all teaching makes use of tasks of different kinds A task based syllabus, however, is one based ... What is task -based syllabus? 2.4.2 The advantages of Task -based language learning 11 2.5 Approaches to syllabus design 12 2.5.1 Language - centered approach 12 2.5.2 Skills- centered approach ... “will be able to with the language at the end of a course of study” The goal of a General English course is usually an overall mastery of the language that can be tested on a global language test...
- 110
- 582
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25