... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager_data_lock call), the kernel issues a pager_data_unlock call The data manager is ... memory as a cache of secondary storage data pages The effect of this kind of caching on the performance of UNIX and its traditional suite of application programs is dramatic Compilation of a small...
Ngày tải lên: 12/09/2012, 15:05
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
Ngày tải lên: 16/03/2014, 01:20
The Design and Implementation of a Sequence Database System * docx
... on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference on Very Large Databases(VWB), ... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... valueis created,or determinedautomatically by the system Catalog Management: Each E-ADT can provide catalogs that maintain statisticsand storeschemainformation Further, certain valuesmay be named Query...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx
... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to accommodate the ... infinitival phrases in place of deverbal nominal constructions Apart from this difference, the major textual characteristics carry over from source to target sublanguage thereby facilitating mechanical...
Ngày tải lên: 17/03/2014, 19:21
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing 39...
Ngày tải lên: 23/03/2014, 14:20
Measuring the Economic Value of a City Park System docx
... by an average of $250 a year McKinley Park, Sacramento PARK VALUE IN ACTION Promoting Human Health in Sacramento Sacramento has 5,141 acres of parks that provide a multitude of ways to stay healthy ... green space in parks First, land cover data are obtained through analysis of aerial photographs This reveals forested as well as open grassy areas and also water surface; it also reveals impervious ... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate...
Ngày tải lên: 02/04/2014, 08:20
Chapter 12 Mass - Storage Systems
... Edition, Jan 1, 2005 12.8 Silberschatz, Galvin and Gagne ©2005 Network-Attached Storage s Network-attached storage (NAS) is storage made available over a network rather than over a local connection ... tertiary storage are bandwidth and latency s Bandwidth is measured in bytes per second q Sustained bandwidth – average data rate during a large transfer; # of bytes/transfer time Data rate when ... that random access within a tape cartridge is about a thousand times slower than random access on disk s The low cost of tertiary storage is a result of having many cheap cartridges share a few...
Ngày tải lên: 13/05/2014, 00:36
Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc
... other than u1 and u2, then the interior of 〚u1, u2〛 is either a subset of the basin of attraction of u1 or a subset of the basin of attraction of u2 Kalabušić et al Advances in Difference Equations ... subset of the basin of attraction of E All orbits that start below this curve are attracted to E1 All orbits that start above this curve are attracted to E (A1 − A2 − β1 + γ2 ) 4B2 R13 A1 = β1 , A1 ... global stable manifold W s(E3) that separates the positive quadrant so that all orbits below this manifold are attracted to the equilibrium point E1, and all orbits above this manifold are attracted...
Ngày tải lên: 21/06/2014, 00:20
Báo cáo hóa học: " Local existence and uniqueness of solutions of a degenerate parabolic system" pptx
... equations of parabolic type Translation of Mathematical Monographs American Mathematical Society, Providence 23 (1968) 15 Friedman, A: Partial Differential Equations of Parabolic Type Prentice-Hall ... Global and nonglobal weak solutions to a degenerate parabolic system J Math Anal Appl 324(1), 177–198 (2006) doi:10.1016/j.jmaa.2005.12.012 Okubo, A: Diffusion and Ecological Problems: Mathematical ... this article as: Zhang et al.: Local existence and uniqueness of solutions of a degenerate parabolic system Advances in Difference Equations 2011 2011:12 Submit your manuscript to a journal and...
Ngày tải lên: 21/06/2014, 03:20
Báo cáo hóa học: " Research Article Dynamics of a Predator-Prey System Concerning Biological and Chemical Controls" ppt
... involves an active human role Natural enemies of insect pests, also known as biological control agents, include predators, parasites, and pathogens Virtually all pests have some natural enemies, and ... fundamental matrix Φ t and the constant matrix M which we call the monodromy matrix of 2.5 corresponding to the fundamental matrix of Φ t All monodromy matrices of 2.5 are similar and have the ... perturbations have been illustrated to substantiate our mathematical results and to show that the system we have considered in this paper gives birth to various kinds of dynamical behaviors Actually,...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article Asymptotic Behavior of a Periodic Diffusion System" pot
... 1983 24 O Ladyzenskaja, V Solonnikov, and N Uraltseva, “Linear and quasilinear equations of parabolic type,” in Translations of Mathematical Monographs, vol 23, American Mathematical Society, ... “Global existence and blow-up for a nonlinear reaction-diffusion system, ” Journal of Mathematical Analysis and Applications, vol 212, no 2, pp 481–492, 1997 Journal of Inequalities and Applications ... Theory, Methods & Applications, vol 60, no 5, pp 977–991, 2005 19 V A Galaktionov, S P Kurdyumov, and A A Samarski˘, A parabolic system of quasilinear ı equations I,” Differential Equations, vol 19,...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article Secrecy Capacity of a Class of Broadcast Channels with an Eavesdropper" potx
... secrecy capacity for a special class of parallel multireceiver wiretap channels was studied in [8] In this class of parallel multireceiver wiretap channels [8], each subchannel exhibits a certain ... message secrecy capacity is the supremum of all achievable secrecy rates The common message secrecy capacity of the parallel multireceiver wiretap channel with a more noisy eavesdropper is stated ... third surface can be achieved with vanishingly small error probability As of now, we showed that all rates in the so-called capacity region are achievable with vanishingly small error probability,...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: "STABILITY OF A DELAY DIFFERENCE SYSTEM" pdf
... Journal of Mathematical Analysis and Applications 318 (2006), no 1, 63–76 [7] M Kipnis and R M Nigmatulin, Stability of trinomial linear difference equations with two delays, Automation and Remote ... stability of solutions of certain linear differential equations with a lagging argument in the Banach space, Doklady Akademii Nauk SSSR 111 (1956), 770–773 (Russian) Mikhail Kipnis: Department of ... A Kuruklis, The asymptotic stability of xn+1 − axn + bxn−k = 0, Journal of Mathematical Analysis and Applications 188 (1994), no 3, 719–731 [9] S A Levin and R M May, A note on difference-delay...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot
... that the elements of the off-diagonal blocks Rη and Rη −1) are negligible compared to the main diagonal elements of Rη Hence, the MAI covariance matrix Rη can be approximated as a block diagonal ... Least Squares Problems, o chapter 9, SIAM, Philadelphia, Pa, USA, 1996 [20] A A Rontogiannis, A Marava, K Berberidis, and J Palicot, “Efficient multipath channel estimation using a semiblind parametric ... subtraction of each estimated path from the received data comes as a natural application of the SAGE EURASIP Journal on Wireless Communications and Networking Table 1: ITU test environment channel...
Ngày tải lên: 22/06/2014, 22:20
Operating System Concepts - Chapter 12: Mass-Storage Systems doc
... Galvin and Gagne ©2005 Network-Attached Storage Network-attached storage (NAS) is storage made available over a network rather than over a local connection (such as a bus) NFS and CIFS are common ... Galvin and Gagne ©2005 Hierarchical Storage Management (HSM) A hierarchical storage system extends the storage hierarchy beyond primary memory and secondary storage to incorporate tertiary storage ... Silberschatz, Galvin and Gagne ©2005 Overview of Mass Storage Structure (Cont.) Magnetic tape Was early secondary -storage medium Relatively permanent and holds large quantities of data Access time...
Ngày tải lên: 28/06/2014, 02:20
Báo cáo khoa học: "Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings" ppsx
... oaks and several acacias, which show marked differences in shoot growth and ramification Materials and Methods Acorns of oaks (Quercus petraea Liebl., Q rubra du Roi) and seeds of acacias (Acacia ... Statistical studies of these ture are data allow the determination of elongation laws and branching patterns They may then be integrated into a deterministic three-dimensional model (Pages and ... entire duration We have recently developed a new method which allows a detailed analysis of growing root system with all its dynamic aspects (Belgrand et al., 1987) It is also a a a root is defined...
Ngày tải lên: 09/08/2014, 02:21
Development of a liposomal nanodelivery system for nevirapine ppsx
... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... myristate loaded liposomes J Pharmazie 2005, 60:840-843 37 Uma Maheswari K, Ramachandran T, Rajaji D: Interaction of cisplatin with planar model bilayers - Dose dependent change in electrical characteristics ... Pharmacological Sciences 2005, 26:2558-2264 13 Fiala M, Murphy T, MacDougall J, Yang W, Luque A: HAART drugs induce mitochondrial damage and intracellular gaps and gp120 causes apoptosis J Cardiovascular...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
... we wanted to revalidate the locomotor monitoring system that our research group designed and validated several years ago The new apparatus allows easier recording of animals by means of a battery ... complete apparatus The apparatus was evaluated by several tests using both mechanical objects with standardized movement and laboratory animals Test The aim of the first test was to verify the ability ... of locomotor activity The locomotor activity of the animal is recorded automatically by means of microwave radar based on the Doppler effect Microwave radar systems operate at the frequency of...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo khoa học: " Introduction of a rapid response system: why we are glad we MET" pps
... Smith G, Prytherch D, Parr M, Flabouris A, Hillman KM: A comparison of antecedents to cardiac arrests, deaths and emergency intensive care admissions in Australia and New Available online http://ccforum.com/content/10/1/121 ... hospital mortality and quality of care Minerva Anesthesiol 2002, 68:25-35 Fresco C, Carinci F, Maggioni AP, Ciampi A, Nicolucci A, Santoro E, Tavazzi L, Tognonia G: Very early assessment of risk ... hospital wards assessing and treating patients in the early phases of clinical deterioration This paradigm shift has been associated with an improvement in the interaction between the ICU and all...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt
... 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview sets were basically identical for both assessments ... at home and school in Tanzania [20] To date no prevalence rates for Tanzania are available [20], but Straus [17] reported that more than two thirds of Tanzanian students did not strongly disagree ... Although many orphanages exist and care for OVC, a detailed evaluation of education and care in orphanages lacks in most cases However, some studies have examined aspects of how orphanages could...
Ngày tải lên: 13/08/2014, 18:22