to three pulse generator by using a pla

... (2004-2009), the Laerdal Foundation for Acute Medicine (Stavanger, Norway) for a randomized trial of a CPR training aid (2007), and the Canadian Institutes of Health Research (Ottawa, ON, Canada) and Medtronic ... CA, USA) in 2007 References 10 11 Competing interests SAW is a member of the American Heart Association (AHA) (Dallas, TX, USA) National Registry for Cardiopulmonary Resuscitation Adult Research ... (San Diego, CA, USA) and Radiant Medical Inc (Redwood City, CA, USA) for single trips in 2006 He consulted for Northfield Laboratories Inc (Evanston, IL, USA) and Paracor Medical Inc (Sunnyvale,...

Ngày tải lên: 13/08/2014, 11:22

... practical, data were collected by means of tests and questionnaires and analysis is also used to process the materials The primary data analysis is of quantitative method with close questions and ... aim is to enable the learners to produce similar texts Learning is evaluated through text analysis of learners work according to some criteria such as the standard of rhetorical style, accurate ... use language intelligible generally legible handwritings accurately and ability to produce clear and appropriate expressions appropriately simple using a fair range of language unsophisticated...

Ngày tải lên: 07/09/2013, 13:43

... Excitation at 488 nm was carried out with an argon ion laser Acquired images were analyzed using image-pro plus 4.5 software Materials o-Aminobenzenothiol was purchased from Fluka (Shanghai, China) ... (3245 cm)1) and C–H (3110 cm)1) also disappeared, while a C ¼ N absorption band at 1618 cm)1 appeared All spectral data indicated that a larger conjugated structure of the DBZTC oxide was formed ... Sigma 1,4-Hydroquinone was from Fluka 4,5-Dihydroxy1,3-benzenedisulfonic acid disodium salt (Tiron) was from Shanghai Reagent Co Ltd (Shanghai, China) All chemicals were of analytical reagent grade,...

Ngày tải lên: 16/03/2014, 11:20

... Nomoto and Y Nitta 1994 A grammaticostatistical approach to discourse partitioning In 15th International Conference on Computational Linguistics (COLING), pages 11451150 H Schmid 1994 Probabilistic ... graph of a series of texts ated to the window center is re-evaluated as the mean of all the cohesion values in the window After this smoothing, the derivative of the graph is calculated to locate ... (Hearst, 1997) The match between a boundary and a document break was accepted if the boundary was no further than words (after pre-processing) Globally, our results are not as good as Hearst's (with...

Ngày tải lên: 31/03/2014, 04:20

... test using HMD may display a greater accuracy and be able to assess the occurrence and grade of USN to a greater degree more than the common clinical test HMD can produce an artificially versatile ... collisions; and a score of (severe neglect) was given when a patient was totally unable to explore the left hemispace A total score was calculated (score range, 0-30) Arbitrary cutoff points were drawn ... unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD) Journal of NeuroEngineering and Rehabilitation...

Ngày tải lên: 19/06/2014, 08:20

... software packages in clinical routine and we therefore used the same normal databases that are available to other users of the software packages Page of The custom normal database used by Wolak et al ... software packages In order to mimic the clinical routine of a European MPS clinic, we evaluated the three software packages with their American normal databases and a gold standard based on a European ... of automatic software packages, to make the interpretations more standardized In a study by Lindahl et al., three physicians separately classified 135 MPS studies twice without a computer-assisted...

Ngày tải lên: 20/06/2014, 23:20

... absorbed the same way every time by the PIM, whereas the initial validation measurement in MLC may vary a week later [7] Hence a day -to- day quality assurance is required to maintain an MLC based ... modulated radiotherapy in nasopharyngeal carcinoma: Dosimetric advantage over conventional plans and feasibility of dose escalation Int J Radiat Oncol Biol Phys 2003, 56(1):143-157 Kataria T, Rawat ... thermoplastic cast was made in the treatment position on the simulator using laser beam alignment and fiducial markers were placed on the thermoplastic cast A planning CT scan with contrast at cross sections...

Ngày tải lên: 09/08/2014, 10:21

... đọc hay, to n tác phẩm tiếng Ai mà thích học qua mua truyện đổi với tớ.:) THÔI VIẾT THẾ NÀY CŨNG TẠM ĐỦ RỒI TỚ GIỮ LỜI H A VỚI BẠN GÌ HAY HỎI QUA FACEBOOK VỚI EM GÌ Ở CLUB RỒI NHÉ Try hard! ... elementary này, hồi năm nghe này, nghe elementary podcast ban đầu to n chả hiểu phải nhìn transcript sau đến số thấy nắm giọng, bắt đầu hiểu, podcast cung cấp nhiều thông tin bổ ích văn h a, ẩm ... nghiện nặng trang ^ ^ - số audio book giọng British , không nhớ ro trang download, người tìm google - phim : xem có extra english giọng British thôi, hay 30 đ a + tập để làm giải trí tiếng anh: chủ...

Ngày tải lên: 22/05/2015, 08:48

... the advances in stem cell and biomaterial research to create a biphasic osteochondral implant that caters to both cartilage and bone regeneration The endeavor was driven by the hypothesis that a ... was initially employed in the production of implant templates and intricate anatomical models required for operative planning [84] Complex anatomies can be readily reproduced as patient data ... chitosan – gelatin composite scaffold to engineer an elastic cartilage implant which exhibited chondrocytic lacuna, GAG deposition and a stiffness that approximated to that of native auricular...

Ngày tải lên: 14/09/2015, 14:07

Ngày tải lên: 29/08/2016, 20:43

... Summarization by Graph Search and Matching Proe of AAAI'97, pages 622-628 Y M a a r e k and A Wecker 1994 The Librarian Assistant: Automatically Assemblin Books into Dy- 1313 namic Bookshelves Proc of RIAO ... et al proposed the scatter/gather approach for facilitating information retrieval (Hearst et al., 1995) Maarek et al related documents by using an hierarchical clustering algorithm that interacts ... is defined on the basis of Salton's Vector Space Model (Salton, 1968) Words are extracted from an article by using a morphological analyzer Next, nouns and verbs are extracted as keywords _ di...

Ngày tải lên: 08/03/2014, 06:20

... of Infant Custody A Plain Letter to the Lord Chancellor on the Infant Custody Bill Again, Lord Brougham argued that, as adultery was by the law of God as great a crime in man as in woman, and reprobated ... communication, demanded as a preliminary to any arrangement, a written retractation of the various charges which had been made against his niece; and so far was Mr Norton at that time from adopting ... had a name and a place among the proudest of the 41 A Plain Letter to the Lord Chancellor on the Infant Custody Bill land: among the members of the legislative assembly of Great Britain; a place,...

Ngày tải lên: 30/03/2014, 13:20

... language Other reason is because of motivation lack to practice the second language in daily conversation They are also too shy and afraid to take part in the conversation Many factors can cause ... taught in almost schools in Vietnam In respond to an appeal from social to improve the quality of education toward regional and international standards, language institutions are marking great ... language user, speaking is a chance to notice the gaps between what you want to say and what you can say, it is a chance to test hypotheses about language The terms “speaking” catches much attention...

Ngày tải lên: 07/06/2014, 16:13

... implant surfaces P = plasma-sprayed titanium (mean Ra = 27 microns); PHA = plasma-sprayed titanium with plasma-sprayed hydroxyapatite coating (mean Ra = 17 microns); CHA = chemical-textured titanium ... Mahwah, NJ Each implant consisted of a cylinder mm in diameter and 25 mm in length (Figure 1) One of three surface treatments was applied to each implant: plasma-sprayed titanium (P), plasma-sprayed ... Scandinavian multicenter porous coated anatomic total hip arthroplasty study Clinical and radiographic results with 7- to 10-year follow-up evaluation J Arthroplasty 1997, 12:133-148 Torchia...

Ngày tải lên: 20/06/2014, 04:20

... a protein Page of Fabrication of the gold nanoisland substrate The gold nanoisland was prepared by the thermal evaporation on a glass substrate (0.8 × 7.0 cm) in a vacuum at a temperature of 65°C ... formation of aggregates in vitro Proc Natl Acad Sci USA 2003, 100:7021 26 Liu H, Zhang X, Gao Z: Lithography-free fabrication of large-area plasmonic nanostructures using colloidal gold nanoparticles ... PH, Tomono H, Nishi N, Yamamoto M, Kakiuchi T: Artificially phaseseparated binary self-assembled monolayers composed of 11-amino-1undecanethiolate and 10-carboxy-1-decanethiolate on Au(1 1): A...

Ngày tải lên: 21/06/2014, 04:20

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... Lusi, E .A. , Passamano, M., Guarascio, P., Scarpa, A. , Schiavo, L., 2009 Analytical Chemistry 81, 2819–2822 Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan, ... Biosensors and Bioelectronics 22, 3126–3131 Planell-Saguer, M., Rodicio, M.C., 2011 Analytica Chimica Acta 699, 134–152 Qavi, A. J., Kindt, J.T., Bailey, R.C., 2010 Analytical and Bioanalytical Chemistry...

Ngày tải lên: 02/07/2014, 14:14

... MW, Vaidya AB, Martin DM, et al.: Genome sequence of the human malaria parasite Plasmodium falciparum Nature 2002, 419:498-511 Nagarajan N, Read TD, Pop M: Scaffolding and validation of bac- Genome ... garnetti (bushbaby) Loxodonta africana (African elephant) Oryctolagus cuniculus (rabbit) Cavia porcellus (guinea pig) Initial Assisted* Initial Assisted* Initial Assisted* Initial Assisted* Bases ... Consortium, Waterston RH, LindbladToh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, Antonarakis SE, Attwood J, Baertsch R, Bailey J, Barlow K, Beck...

Ngày tải lên: 09/08/2014, 20:20

... available only for existing plants in Viet Nam due to the availability of the database supplied by the Load Dispatch Centre of Electricity Vietnam National The data made available included many ... regional displacement scenario involves the displacement of some planned large hydropower plants, nuclear plants in Viet Nam, and a few coal-fired plants Development of the Alternative Scenarios at ... concentrated in central and northeast Thailand and along Viet Nam’s coastline; (ii) biomass potential is concentrated in the major rice-growing areas of the Chao Phraya basin, northeast Thailand, and...

Ngày tải lên: 08/09/2015, 23:32

Ngày tải lên: 08/08/2012, 17:20

... Department Factory Viet A plastic and composite company with abbreviated transaction nameVAPLASCOM, is a subsidiary of Viet A group holdings co., Establishing in October 20th, 2003 Viet A plastic and ... especially in work areas facing major competition In the attempt to hold on to employees, rewards such as cash may play an important role Applying quality management system may regularly fail after ... field are known as quality management Quality management includes both quality control and quality assurance, as well as the additional concepts of quality policy, quality planning, and quality...

Ngày tải lên: 18/04/2013, 17:09