to three pulse generator by using a pal

... (2004-2009), the Laerdal Foundation for Acute Medicine (Stavanger, Norway) for a randomized trial of a CPR training aid (2007), and the Canadian Institutes of Health Research (Ottawa, ON, Canada) and Medtronic ... CA, USA) in 2007 References 10 11 Competing interests SAW is a member of the American Heart Association (AHA) (Dallas, TX, USA) National Registry for Cardiopulmonary Resuscitation Adult Research ... (San Diego, CA, USA) and Radiant Medical Inc (Redwood City, CA, USA) for single trips in 2006 He consulted for Northfield Laboratories Inc (Evanston, IL, USA) and Paracor Medical Inc (Sunnyvale,...

Ngày tải lên: 13/08/2014, 11:22

... practical, data were collected by means of tests and questionnaires and analysis is also used to process the materials The primary data analysis is of quantitative method with close questions and ... aim is to enable the learners to produce similar texts Learning is evaluated through text analysis of learners work according to some criteria such as the standard of rhetorical style, accurate ... use language intelligible generally legible handwritings accurately and ability to produce clear and appropriate expressions appropriately simple using a fair range of language unsophisticated...

Ngày tải lên: 07/09/2013, 13:43

... Excitation at 488 nm was carried out with an argon ion laser Acquired images were analyzed using image-pro plus 4.5 software Materials o-Aminobenzenothiol was purchased from Fluka (Shanghai, China) ... (3245 cm)1) and C–H (3110 cm)1) also disappeared, while a C ¼ N absorption band at 1618 cm)1 appeared All spectral data indicated that a larger conjugated structure of the DBZTC oxide was formed ... Sigma 1,4-Hydroquinone was from Fluka 4,5-Dihydroxy1,3-benzenedisulfonic acid disodium salt (Tiron) was from Shanghai Reagent Co Ltd (Shanghai, China) All chemicals were of analytical reagent grade,...

Ngày tải lên: 16/03/2014, 11:20

... Nomoto and Y Nitta 1994 A grammaticostatistical approach to discourse partitioning In 15th International Conference on Computational Linguistics (COLING), pages 11451150 H Schmid 1994 Probabilistic ... graph of a series of texts ated to the window center is re-evaluated as the mean of all the cohesion values in the window After this smoothing, the derivative of the graph is calculated to locate ... (Hearst, 1997) The match between a boundary and a document break was accepted if the boundary was no further than words (after pre-processing) Globally, our results are not as good as Hearst's (with...

Ngày tải lên: 31/03/2014, 04:20

... test using HMD may display a greater accuracy and be able to assess the occurrence and grade of USN to a greater degree more than the common clinical test HMD can produce an artificially versatile ... collisions; and a score of (severe neglect) was given when a patient was totally unable to explore the left hemispace A total score was calculated (score range, 0-30) Arbitrary cutoff points were drawn ... Patient A and B were 15 and points, respectively The behavioral neglect of Patient A was categorized moderate and Patient B was categorized as a mild level According to the motion analysis of head...

Ngày tải lên: 19/06/2014, 08:20

... software packages in clinical routine and we therefore used the same normal databases that are available to other users of the software packages Page of The custom normal database used by Wolak et al ... software packages In order to mimic the clinical routine of a European MPS clinic, we evaluated the three software packages with their American normal databases and a gold standard based on a European ... of automatic software packages, to make the interpretations more standardized In a study by Lindahl et al., three physicians separately classified 135 MPS studies twice without a computer-assisted...

Ngày tải lên: 20/06/2014, 23:20

... absorbed the same way every time by the PIM, whereas the initial validation measurement in MLC may vary a week later [7] Hence a day -to- day quality assurance is required to maintain an MLC based ... modulated radiotherapy in nasopharyngeal carcinoma: Dosimetric advantage over conventional plans and feasibility of dose escalation Int J Radiat Oncol Biol Phys 2003, 56(1):143-157 Kataria T, Rawat ... Bethesda, MD: International Commission of Radiation Units and Measurments; 1993 Daneil B, Rawat S, Kataria T, Singh SN, Negi PS, Bhalla N, Shah N, Garg C, Munjal RK, Babu AG: Dose reduction to normal...

Ngày tải lên: 09/08/2014, 10:21

... đọc hay, to n tác phẩm tiếng Ai mà thích học qua mua truyện đổi với tớ.:) THÔI VIẾT THẾ NÀY CŨNG TẠM ĐỦ RỒI TỚ GIỮ LỜI H A VỚI BẠN GÌ HAY HỎI QUA FACEBOOK VỚI EM GÌ Ở CLUB RỒI NHÉ Try hard! ... elementary này, hồi năm nghe này, nghe elementary podcast ban đầu to n chả hiểu phải nhìn transcript sau đến số thấy nắm giọng, bắt đầu hiểu, podcast cung cấp nhiều thông tin bổ ích văn h a, ẩm ... nghiện nặng trang ^ ^ - số audio book giọng British , không nhớ ro trang download, người tìm google - phim : xem có extra english giọng British thôi, hay 30 đ a + tập để làm giải trí tiếng anh: chủ...

Ngày tải lên: 22/05/2015, 08:48

... the advances in stem cell and biomaterial research to create a biphasic osteochondral implant that caters to both cartilage and bone regeneration The endeavor was driven by the hypothesis that a ... chitosan – gelatin composite scaffold to engineer an elastic cartilage implant which exhibited chondrocytic lacuna, GAG deposition and a stiffness that approximated to that of native auricular ... chondrocytes and it was coupled to a hydroxyapatite scaffold that served as a carrier for transfected gingival fibroblasts Bone and cartilage formation was noted during subcutaneous implantation [8]...

Ngày tải lên: 14/09/2015, 14:07

Ngày tải lên: 29/08/2016, 20:43

... Summarization by Graph Search and Matching Proe of AAAI'97, pages 622-628 Y M a a r e k and A Wecker 1994 The Librarian Assistant: Automatically Assemblin Books into Dy- 1313 namic Bookshelves Proc of RIAO ... et al proposed the scatter/gather approach for facilitating information retrieval (Hearst et al., 1995) Maarek et al related documents by using an hierarchical clustering algorithm that interacts ... is defined on the basis of Salton's Vector Space Model (Salton, 1968) Words are extracted from an article by using a morphological analyzer Next, nouns and verbs are extracted as keywords _ di...

Ngày tải lên: 08/03/2014, 06:20

... Joint Surg Am 2003, 85 -A: 885-889 49 Herrera A, Canales V, Anderson J, Garcia-Araujo C, Murcia-Mazon A, Tonino AJ: Seven to 10 years followup of an anatomic hip prosthesis: an international study ... Scandinavian multicenter porous coated anatomic total hip arthroplasty study Clinical and radiographic results with 7- to 10-year follow-up evaluation J Arthroplasty 1997, 12:133-148 Torchia ... implant surfaces P = plasma-sprayed titanium (mean Ra = 27 microns); PHA = plasma-sprayed titanium with plasma-sprayed hydroxyapatite coating (mean Ra = 17 microns); CHA = chemical-textured titanium...

Ngày tải lên: 20/06/2014, 04:20

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... Lusi, E .A. , Passamano, M., Guarascio, P., Scarpa, A. , Schiavo, L., 2009 Analytical Chemistry 81, 2819–2822 Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan, ... Biosensors and Bioelectronics 22, 3126–3131 Planell-Saguer, M., Rodicio, M.C., 2011 Analytica Chimica Acta 699, 134–152 Qavi, A. J., Kindt, J.T., Bailey, R.C., 2010 Analytical and Bioanalytical Chemistry...

Ngày tải lên: 02/07/2014, 14:14

... garnetti (bushbaby) Loxodonta africana (African elephant) Oryctolagus cuniculus (rabbit) Cavia porcellus (guinea pig) Initial Assisted* Initial Assisted* Initial Assisted* Initial Assisted* Bases ... MW, Vaidya AB, Martin DM, et al.: Genome sequence of the human malaria parasite Plasmodium falciparum Nature 2002, 419:498-511 Nagarajan N, Read TD, Pop M: Scaffolding and validation of bac- Genome ... Consortium, Waterston RH, LindbladToh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, Antonarakis SE, Attwood J, Baertsch R, Bailey J, Barlow K, Beck...

Ngày tải lên: 09/08/2014, 20:20

Ngày tải lên: 08/08/2012, 17:20

... the basis of tests using the same batch of sludge sample Acetate and VFAs concentrations were verified using a Hewlett-Packard® 588 0A gas chromatograph, equipped with a flame ionization detector ... profile of TAD supernatant and NaAc addition Observed CO2 evolution rates were similar in both cases, and the TAD supernatant VFA estimations are shown in Table Estimations showed a substantial overestimation, ... Reading (V) Figure Carbon dioxide sensor calibration with air samples TAD operation A pilot-scale, single-stage TAD (75L) equipped with a Turborator® aerator (Turborator® Technologies Inc.) was...

Ngày tải lên: 05/09/2013, 08:40

... daily to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are Chemical Oxygen Demand (COD), Total Nitrogen (TN), Total Phosphorus ... conducted by Rajakumar, R and Meenambal, T [3] to investigate the performance for each hybrid UASB reactor and anaerobic filter (AF) reactor, where the comparison of this study was mainly compared ... Habeeb, S A. , AB Aziz Bin Abdul Latiff., Zawawi Bin Daud., Zulkifli Bin Ahmad A review on granules initiation and development inside UASB Reactor and the main factors affecting granules formation process...

Ngày tải lên: 05/09/2013, 16:11

Ngày tải lên: 21/09/2013, 05:29

... Certificate Server Click Next On the Data Storage Location page, accept the defaults for where you want to put the Certificate database and Certificate Database Log You have the option to Store ... computers are all going to need a certificate from the standalone root CA We won’t be able to obtain a certificate for the EXTERNALVPN and EXTERNALSRV computers until we have the gateway to gateway ... information to make it easier to figure out what the CA is for Click Next On the Data Storage Location accept the defaults in this lab You not need to create a shared folder for storage configuration...

Ngày tải lên: 18/10/2013, 14:15