tissues indirect evidence for a role in eye physiology
Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx
... latter may have a sublocalization critical for the observations looking at ouabain as a signal-transducer Experiments pointing to a pivotal role of ouabain in signal-transduction In the following, ... another group in collaboration with Hamlyn [21] by means of two independent assays, a radioimmunoassay using an anti-ouabain Ig and an enzymatic assay using ouabain-sensitive Na+/K+ATPase from dog ... larger changes in intracellular Na+ and Ca2+ may thus be the result of a ouabain interaction with subpopulations of Na+/K+ATPase [27] An overall increase in intracellular Na+ was seen in the experiments...
- 4
- 423
- 0
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt
... plasma membrane of hepatocytes Exp Cell Res 173, 473–485 Weisz OA, Machamer CE & Hubbard AL (1992) Rat liver dipeptidylpeptidase IV contains competing apical and basolateral targeting information ... IV activates an associated tyrosine kinase and triggers an apoptotic signal in human hepatocarcinoma cells Hepatology 27, 934–942 Biemesderfer D, Dekan G, Aronson PS & Farquhar MG (1992) Assembly ... notably albumin (66 kDa), indicating that during permeabilization, soluble luminal proteins were washed out (Fig 4B) A number of proteins ‘disappeared’ following treatment with proteinase K alone...
- 12
- 738
- 0
báo cáo khoa học: " Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine" pptx
... 5-AAGCCAAGGAATCACCCATT-3; for the internal reference gene EF1 -a (GSVIVT00024496001-8.4x) the oligos are 5-AGGATGGACAAACCCGTGAG-3 and 5-AAGCCAGAGATGGGGACAAA-3, and the amplicons have a predicted ... both parental Page of 18 linkage maps (Additional file 3) The mapping data set for LG 18 in Ruby Seedless (RS) and Sultanina (S) included a total of 27 co-dominant markers (Additional file 4), among ... 2B and Additional file 3) An INDEL revealed by p1_VvAGL11 affects a putative O2-like box, p2_VvAGL11 marks a putative TATA-box near far the transcription start site and p3_VvAGL11 marks a (GAGA)n...
- 19
- 389
- 0
Báo cáo y học: " Angiotensin-converting enzyme 2 autoantibodies: further evidence for a role of the renin– angiotensin system in inflammation" potx
... renin–angiotensin system and in ammatory events [5] Pre-eclampsia is associated with circulating autoantibodies against the AT1 protein that act as functional receptor agonists to promote vasoconstriction and ... ACE inhibition ameliorated the autoimmune in ammation [7] The present findings by Takahashi and colleagues reveal increased expression of circulating ACE2 in patients with vasculopathy utilizing ... potential importance in our understanding of the role of circulating and tissue sources of ACE2, particularly in various disease states Increased circulating levels of ACE2 may reflect a compensatory...
- 2
- 364
- 0
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx
... conception and design of the experiment and participated in the data analyses and interpretation MSR conceived the study, helped to collect the data, participated in the data analyses and interpretation, ... Hattar et al [9], Panda et al [10] and from Bullough et al [11] seem to demonstrate that classical photoreceptors (rods and cones) as well as melanopsin-expressing RGCs participate in circadian ... the albino Wistar rat follow a circadian pattern Finally, these findings might provide additional insight into the reported changes in visual thresholds at night [18] Page of (page number not for...
- 9
- 363
- 0
Báo cáo y học: " Updating the evidence for the role of corticosteroids in severe sepsis and septic shock: a Bayesian meta-analytic perspective" pot
... colleagues Annane and Table Trial patient data by outcome (Continued) #, mortality statistics for Chawla and colleagues [47] were abstracted from the Annane and colleagues meta-analysis[6] ##, data ... colleagues Tandan and [36] and colleagues meta-analysis[6] GIS, gastrointestinal; NA, not available 186/234 15/234 13/232 NA NA NA NA NA NA NA NA NA NA NA NA NA NA 11/150 8/149 27/150 22/150 46/115 65/114 ... Glucocorticoid action on inflammation [57], vascular reactivity [58] and interactions between corticosteroids and ‘signalling pathways’ [59] may explain the salutary effects in sepsis [60]; anti-inflammatory...
- 15
- 536
- 0
Báo cáo khóa học: FRET evidence for a conformational change in TFIIB upon TBP-DNA binding pptx
... using small-angle X-ray scattering [28] suggests that NTD does make an intramolecular interaction with the CTD in apo TFIIB, yet how this changes upon binding to an TBP–DNA complex remained largely ... this structural constraint, it is fairly safe to assume that a change in FRET with CYIIB monitors a conformational change in TFIIB Similar FRET-based conformational indicators have been successfully ... C-terminal core domain of human TFIIB: similarity to cyclin A and interaction with TATA-binding protein Cell 82, 857–867 Wu, W.H & Hampsey, M (1999) An activation-specific role for transcription factor...
- 9
- 305
- 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea gigas C1 domain 76 88 Wit D melanogaster ActR-2b H sapiens 92 Activin ... in a basal spiralian: cell lineage analyses in the polyclad turbellarian Hoploplana inquilina Dev Biol 179, 329–338 48 Lambert JD & Nagy LM (2002) Asymmetric inheritance of centrosomally localized ... (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although Cg-BMPR1 and Cg-TGFbsfR2 transcripts...
- 17
- 508
- 0
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... stoichiometry 5¢-GGAGGAAATAAGCATATGGATATG-3¢ (forward), containing an NdeI site, and 5¢-CCTTTCAGGAAGCT TCCTCC-3¢ (reverse), containing a HindIII site The PCR product and plasmid pt7-7 [25] were ... Ltd, Cambridge, UK) Alternatively, the rotational power spectrum of each individual particle was calculated and then averaged (data not shown) It appeared that all averaged classes showed a stoichiometry ... ring of the Spirulina platensis F-ATP AFM data analysis and image processing Individual particles of the AFM topographs were selected manually and subjected to reference-free alignment and averaging...
- 10
- 477
- 0
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot
... significant amounts in homopolysaccharides, branched and de-branched arabinans, and heteropolysaccharides such as arabinoxylans and arabinogalactans Arabinan is composed of a- 1,5-linked l-arabinofuranosyl ... including arabinan, arabinoxylan and arabinogalactan [6,7] ABNs attack the glycosidic bonds of the a- 1,5-l-arabinan backbone, releasing a mixture of arabinooligosaccharides and larabinose [4] ... binding and stabilizing the substrate in the active site Experimental procedures Substrates Debranched arabinan (linear a- 1,5-l-arabinan, purity 95%) and a- 1,5-l-arabinooligosaccharides (arabinohexose,...
- 13
- 568
- 0
Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc
... (Molecular Dynamics, Amersham Biosciences, NJ, USA) was used for quantitation, using b-actin for normalization Statistics Statistical analysis of data utilized anova with least significant difference ... each tissue (hydroxymethylbilane synthase for brain, eyes and skeletal muscle; small-subunit RNA for liver; and TATA box-binding protein for heart) The relative expression of mRNA was calculated ... E Fordel et al Fago et al [10] described a mathematical model of retinal O2 supply that argues that Ngb plays a role in scavenging ROS and reactive nitrogen species that are generated following...
- 6
- 391
- 0
Research for a Future in Space: The Role of Life and Physical Sciences ppt
... well as their temporary sense of well-being Astronauts selected and trained for spaceflight produce a baseline of health data against which testing performed in space can later be compared Certain ... is a two-fold task involving horizontal integration (multidisciplinary and transdisciplinary) and vertical translation (interaction among basic, preclinical, and clinical scientists to translate ... brain’s natural (circadian) sleep/wake rhythm—is necessary for maintaining optimal health, alertness, and performance Cardiovascular functioning depends on the delivery of blood to all organs at...
- 33
- 348
- 0
Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx
... large stomatal opening that induces transpiration is a necessary consequence of the plant’s need to maintain gas exchange in leaves for photosynthesis To maintain a favourable water balance, an ... branches are able to sustain a high climatic water demand and are able to resist to water deficit by maintaining xylem integrity with a low vulnerability and an efficient stomatal response Vulnerability ... conductance, differences in leaf area being weak (see table I) As a consequence, a given transpiration rate induces a larger water potential drop in the shade that in the sun-exposed branches...
- 10
- 329
- 0
báo cáo khoa học: " Multiple evidence for the role of an Ovate-like gene in determining fruit shape in pepper" pptx
... exception being AtOFP6 which contains asparagine) In subf the corresponding amino-acid in position 23 is mainly asparagine while in subf is arginine The amino-acid in this position in subf is mainly ... predicted amino-acid sequence A C terminal DUF623 domain was identified on the predicted amino-acid CaOVATE sequence, a domain which exists in all AtOFPs and Solaneceaous OVATE proteins as well as in ... DUF623 domain, characteristic of OFPs Bioinformatics analysis placed CaOVATE in the same protein subfamily with functionally equivalent proteins from Solanaceae plants, including tomato, and three...
- 16
- 502
- 0
Báo cáo khoa học: " Bioinformatic evidence for a stem-loop structure 5''''-adjacent to the IGR-IRES and for an overlapping gene in the bee paralysis dicistroviruses" pptx
... (as summarized in Ref [11]) are underlined Predicted base pairings are indicated by paired parentheses and coloured background shading Substitutions that maintain the predicted base pairings are ... Nishiyama T, Yamamoto H, Shibuya N, Hatakeyama Y, Hachimori A, Uchiumi T, Nakashima N: Structural elements in the internal ribosome entry site of Plautia stali intestine virus responsible for binding ... coding sequence for initiation of methionine-independent translation in Plautia stali intestine virus J Virol 2003, 77:12002-12010 Hatakeyama Y, Shibuya N, Nishiyama T, Nakashima N: Structural...
- 8
- 258
- 0
Báo cáo y học: "Evidence for a second class of S-adenosylmethionine riboswitches and other regulatory RNA motifs in alpha-proteobacteria" pps
... GGCCG.AGG AAC.AUGCC GAUUUGAUA AUCAGCUUGCG.GGCAU UAAAAAACA GCUAAAGC.GGU GCA AAGUGUGGACAGAUUU GAGCAGCUUGCA.ACCACGGAAAAAAAU GCUAAAACACGUC UUG UUCGGCGCC GAUUUGC CUGAUCCGCUUGCG.GGCGCCUCUUAUAAAUCCAGCUAAAGA.GGUCUGAAU ... UCCCGUGGU GAUUUGGC CGGUCGGCUUGCA.GCCACGUUAAACAAGUC GCUAAAG GACCG.UUG AGCCGUGGU GCUUUG UGCCGGAUUGCGGGCCACGUUAAAGAAACC GCUAAAGA.GGCG AGG ACUCGUGGU CAUUUGAGC.CGGCCGGCUUGCA.GCCACGUUAAACAACUC GCUAAACA.GGCCG.GGG ... UCCCGUGGU GAUUUGAG.CCGGCCGGCUUGCA.GCCACGUUAAACAAGUC GCUAAACA.GGCCGGGGA UCCCGUGGU GAUUUGGC CGGUCGGCUUGCA.GCCACGUUAAACAAGUA GCUAAAAA.GGCCG.GGU AUCCGUGGU GAUUUGGC CGGCCGGCUUGCA.GCCACGUUAAAGAAGUC GCUAAAG...
- 10
- 401
- 0
Báo cáo sinh học: "Polymorphism of β-casein in the Creole goat of Guadeloupe: evidence for a null allele" doc
... caprine -casein 51 a and characterization of those of its genetic variants which are synthesized at a high level, a! l-Cn A, B and C Protein Seq Data Anal 2, 181-188 Brignon G, Mahé MF, Ribadeau-Dumas ... #-Cn° Although infrequent, the null allele #-Cn° may be widespread, since a null individual was observed in the Italian Garganica dairy breed (Dall’Olio et at, 1989), and another in the local dairy ... mutants in that they are associated with less o in milk than the normal or strong alleles, a! l-CnA!B and C i-casein s The characterization of the protein variants was carried out by Brignon et al...
- 6
- 294
- 0
Evolutionary psychology of jealousy in romantic relationships evidence for a sexually dimorphic response mechanism in humans
... that their mate will engage in extradyadic copulation For example, among Plecia nearcticas, aptly laown as "love bugs," after a male gains access to a sexually receptive female he remains attached ... Differences in Jealousy 50 auditioning for a part in a local play At the casting call, the director mentions that one of the roles will involve a substantial amount of onstage kissing and some sexual ... heterosexual, married participants were recruited for Study 2, 16 males and 17 females All participants lived in the Washington, DC metropolitan area Average age of participants was 50.5 years, with a...
- 105
- 253
- 0
Tài liệu Trading For A Living In The Forex Market_2004(pdf) pdf
... price change during a certain time preceding exchange deals, as well as technical indicators The latter are obtained as a result of the mathematical processing of averaging and other characteristics ... market a bank serving a trader tells the latter the quota – an evaluation of the currency traded against the U.S dollar or another currency A quota All training material found in this manual and ... system allows the bank to deal again In the inter-bank market, traders deal directly with dealing systems, matching systems, and brokers in a complementary fashion All training material found in...
- 75
- 650
- 4
PHÂN TÍCH báo cáo NGHIÊN cứu state owned enterprises (SOEs) in vietnam perceptions of strategic direction for a society in transition
... tài: “State-owned enterprises (SOEs) in Vietnam Perceptions strategic direction for a society in transition” Tạm dịch: Nhóm - Lớp Đêm - K22 Tiểu luận môn PPNCKH GVHD: TS Đinh Thái Hoàng date]TiTi6 ... lãnh đạo vấn, ý định cấu lại doanh nghiệp họ kinh tế cạnh tranh toàn cầu kinh tế Việt Nam ch a hoàn toàn mở c a để doanh nghiệp cạnh tranh cách tự do, bình đảng Thứ hai, tác giả tiếp tục phân tích ... rào cản: - Kinh nghiệm người vấn: Tâm lý kinh nghiệm người vấn đóng vai trò quan trọng Có trường hợp người vấn khai thác hết thông tin khó để nhận biết kiến chủ quan người vấn Ngoài ra, gặp gỡ...
- 18
- 676
- 2
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25