this line style is defined as a 1 point red line

... value) and the reaction norm parameter ryk ,a0 = σao + xk ra0 ,a1 a1 /σyk (4) Selection response for a linear reaction norm model 4 41 ryk ,a1 = ra0 ,a1 σao + xk a1 /σyk (5) and for level and slope, ... σ 21 a e a and σ 21 are the genetic and environmental variances of slope, and a0 a1 and e σe0 e1 are the genetic and environmental covariances between level and slope, and P = G + E The heritability ... + σ f ,a0 a1 (t) + a0 a1 (t = 0) 4 (12 ) where σm/ f ,a0 a1 is the covariance contributed from the males/females, respectively From Cochran [3] it follows that σm/ f ,a0 a1 (t + 1) = a0 a1 (t)...

Ngày tải lên: 14/08/2014, 13:22

... Zhou and P P Khargonekar An algebraic riccati equation approach to h1 optimization Systems and Control Letters, 11 :85– 91, 19 88 R D Braatz J G Van Antwerp A tutorial on linear and bilinear matrix ... representation In this paper, the mechanical angular speed is considered as a time-varying parameter This particular choice is motivated by the fact that , which causes the system to be nonlinear, can ... formulas for lmibased synthesis Automatica, 32 :10 07– 10 14, Jul 19 96 C W Scherer Mixed H2/H1 control for timevarying and linear parametrically-varying systems International Journal of Robust and...

Ngày tải lên: 26/10/2014, 14:39

Ngày tải lên: 08/08/2012, 17:20

... LibraryDescription_S 7 -12 00_SMS_DOKU_V12_e.pdf Library for STEP Basic V 11 Containing also the outdated library based on STEP V10.5 CE-X25_S7 -12 00_SM S_library.zip Configuration Example X25 (Documentation based ... Entry ID: 25545680 Latest modification Startup-Code and library with the actual version counter V1.2 and the append ant documentations is now adapted to STEP V 11 Additional search terms wireless, ... PLC sem Watchdog [006] - Programas demo PLC S7 -12 00 da SIEMENS (Simatic) This configuration example CE-X25 helps to solve the tasks displayed The focus is on the library blocks which enable SMS-Sending...

Ngày tải lên: 01/07/2014, 21:04

... 2009, 10 :10 63 -10 69 Koizumi W, Narahara H, Hara T, Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi ... 15 .2 11 .5 - 19 .0 0.4 91 м median 12 .8 7 .1 - 18 .4 Age Gender male 13 .2 9.8 - 14 .8 Female 16 .8 10 .7 - 22.8 0 -1 15.2 12 .0 18 .5 м2 7.6 - 16 .5 Advanced 15 .2 11 .7 - 18 .8 Recurrent 12 .1 9 .1 - 15 .1 differentiated ... Yoshida K, Ninomiya M, Takakura N, Hirabayashi N, Takiyama W, Sato Y, Todo S, Terashima M, Gotoh M, Sakamoto J, Nishiyama M: Phase II study of docetaxel and S -1 combination therapy for advanced...

Ngày tải lên: 09/08/2014, 03:21

... followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the ... to COS7 cells affecting the 5E1 epitope Gup1 acts as a negative regulator for N-terminal palmitoylation of Shh Mammalian Gup1 has been described in the gene database cited above as a homolog of ... monoclonal anti-Shh N-terminal fragment, clone 17 1 018 (data not shown) As this antibody also acts as a neutralizing antibody, it probably recognizes an epitope overlapping with that of 5E1 The...

Ngày tải lên: 18/02/2014, 16:20

... in a kiln it is called bisque ware At this stage, the clay has changed composition and can no longer have water added to it and turned back into useable material bronze An alloy of copper and ... Two Parts glaze greenware When clav is leather hard not yet fired it is called greenware At this point, the clay can be made wet and turned back into useable material painting a picture created ... qualities of a particular character (such as Diana, goddess of the hunt) to a modern character (such as Mia Hamm, huntress of a soccer goal) The Huntington Library, Art Collections, and Botanical...

Ngày tải lên: 19/02/2014, 10:20

... hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5 017 [5, 12 , ... fibroblasts Proc Natl Acad Sci USA 10 0, 411 4– 411 9 50 Ryther RC, Flynt AS, Phillips JA III and Patton JG (2005) siRNA therapeutics: big potential from small RNAs Gene Ther 12 , 5 11 FEBS Journal 277 ... p300 ⁄ CBP coactivators J Virol 76, 9724–9734 HIV -1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role...

Ngày tải lên: 06/03/2014, 09:22

... cardiovascular and cerebral pathophysiology of stroke patients, and neuroprotection should be evaluated on a long-lasting and functional basis, rather than on an acute and histological basis Also, ... that inflammatory transcription factors such as nuclear factor-kappaB, activator protein -1 and nuclear factor of activated T-cells are positively regulated by PARP -1 PARP -1 protein per se, as ... cycle and gene expression [23] Among PARPs, nuclear PARP -1 is a DNA damageactivated enzyme of 11 3 kDa molecular mass and is the most abundant and commonly studied member of the family Its enzymatic...

Ngày tải lên: 07/03/2014, 03:20

... differentiated, both structurally and functionally, with highly developed cristae full of ATP synthase complexes For this reason, ATP synthase and in particular the a- F1-ATPase and b-F1-ATPase catalytic ... 2 71) 4009 Fig Functional analysis of the GAGA/Adf -1 cassette in heterologous promoters Hybrid promoters indicate the a- F1-ATPase GAF/Adf -1 binding cassette has enhancer properties (A) The basal ... plasmid pSV-bGAL and the quantification of luciferase was normalized to b-galactosidase activity Luciferase activity was determined using the Luciferase Assay System (Promega) according to manufacturer’s...

Ngày tải lên: 07/03/2014, 16:20

... PO42–E4 8A E G SO42– E4 9A D5 0A 75 PO42– 11 738.2+H 50 SO42– 10 ACS 25 SO42– 10 ACS ACS 11 000 12 500 ACS 0 11 000 12 500 SO42– 10 10 11 000 12 500 11 000 12 500 12 000 14 000 12 000 14 000 12 000 Mass/charge (m/z) ... Da) ACS 10 D50E H PO42– 2– 0 11 000 12 500 11 000 12 500 0 11 000 12 500 12 000 14 000 SO42– ACS 10 12 000 12 000 14 000 14 000 Mass/charge (m/z) 11 000 12 500 12 000 14 000 SO42– 13 782.9 Da (13 792.5 Da) 13 822.2 ... 13 822.2 Da (13 8 21. 5 Da) 13 822.3 Da (13 8 21. 5 Da) 13 853.3 Da (13 849.5 Da) PO42– 13 864.0 Da (13 872.5 Da) 13 898.8 Da (13 9 01. 5 Da) Form sulfated phosphorylated No PO42– (13 9 01 Da) 13 919 .0 Da (13 929.5 Da)...

Ngày tải lên: 16/03/2014, 06:20

... was just about a teenager, so I know Kristin: Well, I, I’ve only moved once, too, when I was a child and I was eight And that was pretty tough for me Pennsylvania: a state in America Joe: Yeah, ... Moving As A Child Part Conversation Kristin: Yeah comes a point: comes a time teenager: a person between 13 and 19 years old Joe: I mean, I’ve had some friends whose parents were in the Army and ... lived there And then I moved to Pennsylvania, rural Pennsylvania I mean, it was a complete… rural: area where there is a lot of farm land Kristin: Oh gosh culture shock: feeling uncomfortable when...

Ngày tải lên: 10/04/2014, 10:44

... He is an army brat What is he? An army brat, he is an army brat Is he an army brat or a plumber? An army brat, he is an army brat Who is an army brat? Is Alex an army brat? Yes, he is Alex is an ... to was rural Did the town that they moved to have a lot of farmland? Yes, it did It was rural, which is the same thing as saying it had a lot of farmland Rural means it had a lot of farmland ... were uncomfortable living in a rural area and a rural area has a lot of farmland, so living in a town that had a lot of farmland made them feel uncomfortable or made them feel like it was culture...

Ngày tải lên: 10/04/2014, 10:44

... Moving As A Child Part POV Lesson * * * * * Okay, so that is the story as if it is happening in the past; as if it has already happened Now let’s hear the story as if it is happening in ... story happening four years from now or, say, in four years Okay, here we go * * * * * In four years Alex’ll be twelve years old He’ll be an army brat His dad will join the Army Alex and his parents ... As A Child Part 1 Now please go back and listen to each version of the story again Then when you feel like you understand one of the stories go back and tell that story on your own Do this for...

Ngày tải lên: 10/04/2014, 10:44

... Now a county… This is a large area that has a city or cities within it For example: You have a city or cities and then you have a county that has the city or cities within it And then a state has ... what military is or means An example of army brats would be: When I was younger I knew a girl named Katie She was an army brat Her family moved five times in six years Army brat, or in this example ... there And then I moved to Pennsylvania ” Now Pennsylvania… This is a northeastern state in America Pennsylvania www.LearnRealEnglish.com © Copyright 2008: Learn Real English, LLC Moving As A Child...

Ngày tải lên: 10/04/2014, 10:44

... incubated in rabbit anti-GLT -1 (1: 1000), rabbit anti-GLAST (1: 1000) (Alpha Diagnostic International, San Antonio, TX), mouse anti-GS (Chemicon International, 1: 2000), rabbit anti-PAR1 (Santa Cruz ... Immunoblotting for glutamine synthetase (GS), glutamate aspartate transporter (GLAST), glutamate transporter -1 (GLT -1) , S -10 0B and protease-activated receptor (PAR -1) , 10 µg of protein were analyzed Blots ... astrocytes after traumatic brain injury, we analyzed the expression of two glutamate transporters, glutamate aspartate transporter (GLAST) and glutamate transporter -1 (GLT -1/ EAAT2), the glutamate The...

Ngày tải lên: 19/06/2014, 22:20

... 12 :18 46 -18 51 Tauchi H, Kobayashi J, Morishima K, Matsuura S, Nakamura A, Shiraishi T, Ito E, Masnada D, Delia D, Komatsu K: The forkhead-associated domain of NBS1 is essential for nuclear foci formation ... MRE 11 and RAD50 [13 ,14 ] In addition, NBS1 recruits the ATM kinase to DSB sites [15 ], and NBS1 [15 ] and ATM [16 ] are then both required to recruit the ATR kinase [16 ] Activation of the ATM and ATR ... and harvested at the indicated time points (Figure 1A) ChIP analysis was used to identify accumulation of NBS1, ATM, and ATR at sites of proviral DNA integration Nuclear DNA and its associated...

Ngày tải lên: 20/06/2014, 01:20

... humanistic practice disease duration of disease disease * duration of disease 0.053 2.047 1. 711 3 .18 8 0.0 91 n.s 0.002 (5) nature-oriented practice SpR attitude age disease duration of disease ... resp Christian Humanism [36] Secular Humanism is an atheistic and naturalistic philosophy promoting humanity as the measure of all things, and roots in the rationalism of the 18 th Century and the ... practice • Disease itself has an impact on NoP (and a minor impact on HuP and USP), while the duration of disease has no impact on the forms of SpR practice However, disease and its duration are...

Ngày tải lên: 20/06/2014, 15:20

... Happiness Dordrecht, The Netherlands: Reidel doi :10 .11 86/2 211 -15 22 -1- 1 Cite this article as: Vella-Brodrick and Rickard: Editorial Psychology of Well-Being: Theory, Research and Practice 2 011 ... disseminate these important research findings has also escalated Consequently, a journal focused exclusively on well-being is warranted Springer, a world leading publisher in social sciences, has astutely ... and Practice 2 011 , 1: 1 http://www.psywb.com/content /1/ 1 /1 and incorporate the latest research findings into their practice, helping to narrow the gap between science and practice This scientist-practitioner...

Ngày tải lên: 21/06/2014, 06:20