... stated) and legal disclaimers All of this peripheral information serves as a constant reminder that a game is being played Another barrier to player immersion in the Nokia Game is its reliance on ... with visitor traffic and inquiries, and its owner was forced MelbourneDAC 2003 to replace his home page with a "This is not a game" disclaimer [5] As you can imagine, an audience that is quite ... social and political action The genre's repeated disavowals that "this is not a game" is more than a catchy tag line; it is a call for further study, development and deployment of immersive gaming's...
Ngày tải lên: 07/03/2014, 17:20
... 14 Kawashima M, Kagami Y, Toita T, Uno T, Sugiyama M, Tamura Y, Hirota S, Fuwa N, Hashimoto M, Yoshida H, Shikama N, Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S, ... Pignon JP, MetaAnalysis of Radiotherapy in Carcinomas of Head and neck (MARCH) Collaborative Group: Hyperfractionated or accelerated radiotherapy in head and neck cancer: a meta-analysis Lancet 2006, ... (ulceration lasting months or more) and/or bone (bone exposure and necrosis) reactions occurred Statistical Analysis For a statistical analysis, a Student’s t-test for normally distributed data and...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' Discussion Our results indicate that there is ... (data not shown) In each assay we performed at least six different reactions for each sample using increasing amounts of competitor DNA The amounts of sample were quantitated by extrapolating across ... numerical values Intact mRNA was successfully extracted from as little as 400 µl of whole blood, comparable amounts to that obtained from infants via heelstick This mRNA was used to quantify the amount...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx
... data collection, data analysis and writing of the manuscript JHDV participated in data analysis and writing of the manuscript JBH participated in the design of the study, data collection, data ... from (cardio)vascular disease because ASA class or was a prerequisite for inclusion in the study, and only 11% had a history of coronary artery disease It could thus be hypothesized that, in a population ... Hyperglycaemia has vasoconstrictive effects [22], which may aggravate tissue ischaemia, particularly in patients with obstructive vascular disease Insulin has been reported to have vasodilatory...
Ngày tải lên: 12/08/2014, 20:20
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... A. -R Karala and L W Ruddock bacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections caused ... thiol–disulfide exchange enzymes, Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding ... binding As well as having oxidase, isomerase and chaperone-like activity, PDI is also able to catalyze the reduction of disulfide bonds The effects of bacitracin on this activity were examined...
Ngày tải lên: 16/02/2014, 14:20
Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc
... F(aa¯ a, aaaa) a ¯ ¯ A( a, a) F (a , aa) a ¯ A( a, a) D (a , aa) a ¯ E (a a, aaa) a ¯ ¯ D (a , aa) a ¯ C(ε, #) A (¯ , a) a ¯ D(ε, ε) F (a , aa) a ¯ A( a, a) D(ε, ε) E(¯ , a) a ¯ D(ε, ε) A (¯ , a) ... A, A , C, D, E, F}, Σ = {a, a, #}, and P consists of the following rules: S(x1 y1 , y2 x2 ) ← D(x1 , x2 ), C(y1 , y2 ) C(ε, #) ← S(aa¯ aa¯ , #¯ a aaa) a a a a D(aa¯ aa¯ , aa¯ aaa) a a ¯ a ... L(G), a derivation tree for w is a derivation tree for some S(w1 , w2 ) such that w1 w2 = w Example (continued) Figure shows a derivation tree for aa¯ aa¯ #¯ a aaa a a a a The following lemma...
Ngày tải lên: 16/03/2014, 19:20
odysseus is not a hero
... this. Outline I) Introduction A) The average definition for a hero B) What Odysseus is like compared to the definition C) Odysseus isn¹t a hero II) Odysseus is self centered A) He doesn¹t take ... members killed at Cyclops¹ because he was being greedy.III) Odysseus is cold-hearted A) He kills people without giving them a chance 1) Suitors 2) Disloyal maids B) He doesn¹t care about people ... prevent deaths of crew membersIV) Odysseus is disloyal A) He had affairs with other women 1) Calypso 2) Circe B) Wife didn¹t betray him 1) with suitors 2) even though he was thought to be dead V)...
Ngày tải lên: 21/03/2014, 22:48
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
... for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the ... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in [T], ... (i.i.d.) Gaussian random variables with mean value and vari *This work was carried out, while the first author was a member of the MaPhySto – Centre for Mathematical Physics and Stochastics, funded...
Ngày tải lên: 22/03/2014, 20:20
Báo cáo toán học: "A hyponormal weighted shift whose spectrum is not a spectral set " doc
Ngày tải lên: 05/08/2014, 15:20
Báo cáo y học: " Minimal acupuncture is not a valid placebo control in randomised controlled trials of acupuncture: a physiologist''''s perspective" pps
... Self- appraisal The brain modulates processes involved in self-appraisal during acupuncture For example, when a patient sees an acupuncturist, there is anticipation of a specific effect [3843] This ... acupuncture analgesia is probably associated with its counter-regulation of spinal glial activation, PTX-sensitive Gi/o protein-mediated and MAP kinase-mediated signal pathways, and downstream ... analgesia: I: The scientific basis Anesth Analg 2008, 106:602-610 Okada K, Kawakita K: Analgesic Action of Acupuncture and Moxibustion: A Review of Unique Approaches in Japan Evid Based Complement Alternat...
Ngày tải lên: 13/08/2014, 15:21
A Project is Not a Black Box docx
... variables change, and the changes are often interrelated Sensitivity analysis using scenarios can help in this regard Operating leverage = a % change in operating income % change in sales For a ... estimate is realized 93 a ‘Optimistic’ and ‘pessimistic’ rarely show the full probability distribution of outcomes b Sensitivity analysis changes variables one at a time, while in practice, all variables ... 1.103 Notice that the answer is the same if we simply assume that the price of gold remains at $500 This is because, at t = 0, the expected price for all future periods is $500 Because this NPV is...
Ngày tải lên: 14/08/2014, 11:20
Barbara park denise brunkus JUNIE b JONES 09 junie b jones is not a crook (v5 0)
... saw! There were sweaters! And sweatshirts! And baseball caps! And gloves! And balls! And a lunchbox! And a scarf! And sunglasses! And a watch with Mickey Mouse on it! Also, there was a backpack ... “My family has lots of fur,” she said “My mother has a fur cape And my aunt has a fur jacket And my uncle has a fur hat Plus my nanna just bought a brand-new mink coat Only she can’t wear it ... backpack again “Maybe I will take this instead,” I said “’Cause this teddy backpack will ease my pain, I believe.” Principal said no “How come?” I asked “’Cause the owner doesn’t even want it anymore,...
Ngày tải lên: 12/07/2018, 16:28
THIS IS NOT YOUR GRANDMA’S GRAMMAR
... participle phrase 13 a contraction, an adverb, and a prepositional phrase 14 a gerund phrase, a prepositional phrase, an adverb, and an adjective 15 an adverb, a prepositional phrase, and an indefinite ... and a prepositional phrase 10 a prepositional phrase that starts the sentence 11 an adjective phrase and an infinitive phrase 12 a question mark, an adverb, an infinitive phrase, and a participle ... good, and bad, points (A) Henrietta Hornacker is as I see it the one to choose as team captain (B) Henrietta Hornacker is, as I see it, the one to choose as team captain (C) Henrietta Hornacker, is...
Ngày tải lên: 25/10/2013, 17:20
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... only a representative sampling from a larger number of such registrations revealed by his search Ser No 75/934,127 Applicant filed a Notice of Appeal with the Trademark Trial and Appeal Board, along ... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company sells...
Ngày tải lên: 20/12/2013, 23:15
Báo cáo y học: "Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk-of-bias assessment" pot
... Christensen R, Bliddal H: Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk-of-bias assessment Arthritis ... osteoarthritis Osteoarthritis Cartilage 2000, 8:9-12 Christensen R, Bartels EM, Astrup A, Bliddal H: Symptomatic efficacy of avocado-soybean unsaponifiables (ASU) in osteoarthritis (OA) patients: ... inconsistency [3,9] The glucosamine sulfate product from Rottapharm Madaus (Monza, Italy) is one exception to this [10] While trials of this particular preparation showed promise in the early days...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... sequence in tail biopsy DNA samples (5'primer: GAT ACT AGA AGT GAG GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ACG AAC) and selected for further matings with n-tg Sprague-Dawley rats Transgene ... translate into an enhanced viral gene expression in this primary cell type, and already macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to the ability of HIV-1 ... Statistics Unpaired Student's t-test analysis was calculated with the software MS Excel 2003 For the data presented in Fig 10B a linear model variance analysis (repeated measurement design) was...
Ngày tải lên: 13/08/2014, 05:21
The following is a list of colours. A number of the color swatches below are taken from domainspecific naming schemes such as X11 or HTML4. RGB values are given for each swatch because such standards are defined in terms of the sRGB color space. It is not
... rectangle heart triangle star square circle ...
Ngày tải lên: 02/06/2015, 23:04
this is a document for free using. anyway, Im just trying my best to fill the 20 characters limit _
Ngày tải lên: 11/09/2016, 20:22