primate neuroethology mar 2010
... Seyfarth and Dorothy L Cheney 84 Rational Decision Making in Primates: The Bounded and the Ecological Jeffrey R Stevens 98 Primate Social Cognition: Thirty Years After Premack and Woodruff Alexandra ... Psychology University of St Andrews St Andrews, Scotland This page intentionally left blank CONTENTS Introduction Michael L Platt and Asif A Ghazanfar Primate Classification and Diversity Matt Cartmill ... and physiological and anatomical mechanisms (Hinde, 1982) Defining and operationalizing species typical behaviors for neurobiological study and veying neurobiological results to ethologists and...
Ngày tải lên: 11/06/2014, 10:15
... peers, culture, media, and technology on health behavior; knowing how to access and use valid health information; and using communication, decision-making, goal-setting, and advocacy skills to ... between school health education and health literacy.22 Health literacy is the capacity of individuals to obtain, interpret, and understand basic health information and services in ways which are ... Education Standards Employing highly qualified and effective health educators Ensuring recommended health education instruction time at the elementary and secondary levels Having a national plan and...
Ngày tải lên: 14/02/2014, 13:20
... peers, culture, media, and technology on health behavior; knowing how to access and use valid health information; and using communication, decision-making, goal-setting, and advocacy skills to ... between school health education and health literacy 22 Health literacy is the capacity of individuals to obtain, interpret, and understand basic health information and services in ways which are ... Education Standards Employing highly qualified and effective health educators Ensuring recommended health education instruction time at the elementary and secondary levels Having a national plan and...
Ngày tải lên: 22/03/2014, 15:21
Solution for the perfection of Viettel strategic business market in Cambodia (2010 - 2015)
Ngày tải lên: 26/03/2015, 09:41
THE ROLE OF TRANSFORMATIONAL LEADERSHIP BEHAVIORS IN AFFECTIVE EMPLOYEE ENGAGEMENT AN EMPIRICAL STUDY IN THE TWO INDUSTRIES OF RETAIL AND FINANCIAL SERVICES IN HO CHI MINH CITY
... Percent Gender Male 160 50 Female 160 50 Under years 193 60.3 to years 81 25.3 Above years 46 14.4 Under years 120 37.5 to years 145 45.3 Above years 55 17.2 Private 177 55.3 Foreign-owned 143 ... to the employees by handout and online survey in October 2012 in which handout contributed to 213 samples and online survey contributed to 107 samples 3.2.2 Data sources and type In order to ... current manager and the employees also had at least years of working experience so that they could have enough capability to understand and answer the survey 3.1.2 Data collection and In-depth interview...
Ngày tải lên: 01/06/2015, 20:09
Four essays on the economics of pro social behaviors
... for CR and ER plans, and for CNR and NR plans We also controlled for the gender of our subjects, Di gender, (1 for female and for male) and nationality, Di nationality , (1 for local and for ... direct-mail solicitations, both List and Karlan (2007) and Smith and Berger (1996) found that suggested donations have no influence on donors' giving decisions Reingen (1982) and Fraser et al (1988) found ... increases However, Brockner et al (1984), Smith and Weyant (1987), and Smith and Berger (1996) Brockner et al (1984) conducted a field study of door-to-door and telephone donation solicitation both...
Ngày tải lên: 10/09/2015, 09:03
essays in behavioral economics in the context of strategic interaction
... Crawford and Broseta (2001) (CGCB hereafter) estimate that 45% of the population are L1 and 44% are L2 The strong presence of L1 seems to be confirmed by CostaGomes and Weizs¨cker (2005) (CGW hereafter) ... and B 0.072 0.013 A and C 0.139 0.86 B and C 0.791 0.024 Table 1.7: Hypotheses Tests between Treatments The p-values for the comparison of pN RN + pN RA between A and B as well as between A and ... investing) and timing of investment is endogenous This game involves two key forces: on the one hand, there is an opportunity to wait and observe investment activity by others; on the other hand, there...
Ngày tải lên: 03/06/2014, 01:07
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... #!!(),)## 1.23452/0267/8 '"# Figure Band intensities for Nitrobacter species While in Figure 4, the band intensities were high only in Runs and 7, and their band intensities were quite similar, ... with PCR and FISH By both of PCR and FISH analyses, only Nitrobacter species were detected The PCR result with FGPS primer set is shown in Figure The band intensitis were quantified, and were ... CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r...
Ngày tải lên: 05/09/2013, 09:38
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... political, and cultural circumstances and its impact on the borrowers’ behavior A low literacy rate, depriving economic conditions, extreme political involvements and pressures, inflexible and unsupportive ... to their understanding of the borrowers’ behavior and support by the state authorities REFERENCES Anderson, C., L., Locker, L., & Nugent, R (2002) Microcredit, social capital, and common pool ... understand the challenges and issues restraining their success through intense academic research, which would enable them to develop microfinance models tailored to suit the perceptions and expectations...
Ngày tải lên: 06/09/2013, 05:48
CHAPTER 5 The Logic of Group Behavior In Business and Elsewhere
... eradicating dandelions? We can address this question with the use of the public goods demand curve developed earlier The common interest is dandelion eradication; and two neighbors, Fred and Harry, ... constructed Fred and Harry’s joint, or public good, demand curve Their collective demand curve is obtained by vertically summing the demands of the individuals Under individual action, Q1 dandelions ... capital (such as the building, the land, the machinery, and the office furniture), provides the raw materials and other supplies used in the business, and hires and supervises the workers necessary...
Ngày tải lên: 17/12/2013, 15:18
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... situation and environment and made a self-interested decision to behave as they Primary and selective demand Commercial managers generally seek changes in selective demand after the primary demand ... clearly and consistently is acknowledged and pursued In the commercial sector, managers appeal to consumers' self-perception of short- and long-run self-interest (e.g., "buy my brand and you ... that mandates individual behavior For Taylor and Singleton (1993), the distinction between marketing and law could be that marketing works through self-monitoring and self-sanctioning after negotiating,...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu The Basics of Social Marketing - How to Use Marketing to Change Behavior docx
... roles and responsibilities clear? ® Do the timelines and budgets appear reasonable, and they fit your departmental schedules? ® Are necessary review/clearance and procurement mechanisms clear and ... pre-testing the messages and materials clear and feasible? Review the work plan ® Are roles and responsibilities clear? ® Do the timelines and budgets appear reasonable and fit your departmental ... departmental reporting and/ or accountability requirements? Review the monitoring and evaluation plan ® Are roles and responsibilities clear? ® Do the timelines and budgets appear reasonable and fit your...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu STRATEGIC ENVIRONMENTAL ASSESSMENT on shrimp farms in the southeast of Thailand docx
... Previous land use before shrimp farm development in the south of Thailand Previous land use Rice fields Fruit, vegetable or other agriculture Mangrove / Wetland Uncultivated land / Wasteland Extensive ... life of 10 years in Thailand (Gujja and Finger-Stich, 1996) According to a survey performed by Funge-Smith and Stewart (1996) the average life of shrimp farms in southern Thailand is – years Since ... Thailand Thailand is a tropical country in Southeast Asia with a population of about 60 million people and a total land area of 514 000 sq.km The country borders to Malaysia, Lao PDR, Myanmar and...
Ngày tải lên: 26/02/2014, 20:20
WORKING PAPER SERIES NO. 398 / OCTOBER 2004: MERGERS AND ACQUISITIONS AND BANK PERFORMANCE IN EUROPE THE ROLE OF STRATEGIC SIMILARITIES potx
... (see, e.g Houston and Ryngaert, 1994 and Berger, Demsetz and Strahan, 1999).4 By contrast, the handful of cross-country European studies conducted to date, finds that banks mergers and acquisitions ... see Houston and Ryngaert (2001) for the United States and Beitel, Schiereck and Wahrenburg (2003) for European evidence Comparing ex- and post-merger performance among European banks, Vander Vennet ... and acquisitions and their impact on shareholder returns: evidence from the '90s", Quarterly Journal of Business and Economics 37, 4, pp 48-56 Vander Vennet, R (1996), The effect of mergers and...
Ngày tải lên: 06/03/2014, 09:22
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... 1985, and Exclusive Economic Zone Act, 1984), vessel operation and conduct (The Merchant Shipping Ordinance, 1952), land use pattern (National Land Code, 1965, and Land Conservation Act, 1960), and ... alluvial tin and sand, caused widespread degradation of areas with mineral deposits leaving behind sandy, barren and unfertile land, unattended water bodies, and silted waterways Landslips, particularly ... regulations stipulate the standards and procedures for handling the various types of domestic and industrial wastes Stakeholders and Water Resource Management The conservation, use, and management of water...
Ngày tải lên: 06/03/2014, 15:21
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx
... Survey and the Integrity Line for employees, survey and focus groups for customers and Nutritional label and Green Index, factory assessments and capacity building for suppliers etc (Eccles and ... Human Rights Standards), labor standards/requirements (18.6% vs 8.1%, Labor Standards), and occupational, health, and safety standards (62.9% vs 25.7%, OHS Standards) Finally, High Sustainability ... with Hills and Jones (2001), as ―the specific collection of values and norms that are shared by people and groups in an organization and that control the way they interact with each other and with...
Ngày tải lên: 06/03/2014, 20:21
Strategic Directions of the Department of Maternal, Newborn, Child and Adolescent Health ppt
... teams and cross-cutting groups Research and Development for MNCAH Collect, review and assess evidence to develop evidence based norms and standards to inform policy, guide norms and standards and ... interventions and delivery approaches, and use and share the knowledge base for formulation of policies, guidelines and tools for MNCAH; and • Work with countries and partners on the dissemination and ... childbirth and the post-natal period and appropriate home care for mothers and babies Care in the newborn period and in childhood: Care and support for health, growth and development and prompt...
Ngày tải lên: 07/03/2014, 04:20
The National Road Map Strategic Plan To Accelerate Reduction of Maternal, Newborn and Child Deaths in Tanzania 2008 - 2015 potx
... maternal, newborn and child care including FP and nutrition • Developing and providing an orientation package and other educational materials to tutors and clinical preceptors • Update and standardize ... interdependent; maternal morbidity and mortality impacts neonatal and under-five survival, growth and development Thus service demand and provision for mothers, newborns and children are closely interlinked ... developemnt and monitoring and evaluation of MNCH services • Advocate for increased global and national commitment to the reduction of maternal, newborn and child morbidity and mortality • Mobilise and...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: X-ray crystallography, CD and kinetic studies revealed the essence of the abnormal behaviors of the cytochrome b5 Phe35fiTyr mutant pdf
... [21] that the core consists of b-strand III (Tyr27–Leu32), b-strand II (Thr21–Leu25), b-strand I (Lys5–Tyr7) and a-helix I (Thr8– His15) Trp22, Tyr6, Tyr7, Tyr27 and Tyr30 are the main aromatic components ... usually develops an optimal architecture to fulfill its biological functions after hundreds and thousands years of evolution and natural selection Artificial site-directed mutagenesis of proteins most ... structure and the above detailed studies the essence of these unusual behaviors is discussed MATERIALS AND METHODS Protein preparation Bovine liver cyt b5 and its mutants were prepared and purified...
Ngày tải lên: 08/03/2014, 10:20
Division of the Chief Health Officer Strategic Directions for Mental Health Promotion 2009–2012 pptx
... Published by Queensland Health August 2009 ISBN 978-1-921447-79-2 © The State of Queensland (Queensland Health) 2009 The Queensland Government supports and encourages the dissemination and exchange ... disease and cancer) is growing, and substantial inequalities in health status for Aboriginal and Torres Strait Islander people, socioeconomically disadvantaged people and those living in rural and ... Aboriginal and Torres Strait Islander Australians in Queensland Define the working relationship between mental health promotion staff and the Queensland Centre for Mental Health Promotion, Prevention and...
Ngày tải lên: 08/03/2014, 15:20