thermal properties of air at 1 bar pressure

... 267 ± 51 ± 16 256 ± 10 0.20 ± 0.03 227 ± 12 17 ± 27 230 ± 10 0 .10 ± 0.02 258 ± 10 ± 11 262 ± 10 0.04 ± 0.04 230 ± 10 50 ± 20 219 ± 12 0. 21 ± 0 .1 E v Results The synopsis of the calculated elastic ... deformation (4) Shear deformation ζ ζ 0 0 ζ 0 ζ ζ ζ C 11 2(C 11 + C12 ) C22 ≡ C 11 4C44 ≡ 2(C 11 − C12 ) Table Independent elastic constants (units of Nm 1 ) are shown for different values of the ... treatment to enhance their crystalline quality before the carbon implantation [6, 11 ] The doses of carbon implanted in the nickel thin films are × 10 15 , 1. 6 × 10 16 , 2.4 × 10 16 and 3.2 × 10 16 atoms/cm2...

Ngày tải lên: 24/03/2014, 01:20

... http://www.tbiomed.com/content/6 /1/ 31 provides the option of posting comments on contentious articles within days of their online publication References 10 11 12 13 14 Preuss M, Miller AD: The affinity of the GroEL/GroES ... 2007, 14 :32 21- 32 31 Ikehara K: Pseudo-Replication of [GADV]-proteins and origin of life Int J Mol Sci 2009, 10 :15 25 -15 37 Rodin SN, Rodin AS: On the origin of the genetic code: signatures of its ... different physicochemical properties It is also broadly compatible with the work of Ikehara and colleagues [10 ,11 ] and of Rodin and Rodin [12 ] on the origin and evolution of the genetic code However,...

Ngày tải lên: 13/08/2014, 16:20

... VAP2b ⁄ catrocollastatin and catrocollastatin C may be explained by disulfide bond shuffling during experimental determination of cysteinyl pairs for catrocollastatin C (an explanation that we feel ... the Bothrops alternatus snake venom that interacts with alpha5beta1 integrin Arch Biochem Biophys 416 , 17 1 17 9 12 Robeva A, Politi V, Shannon JD, Bjarnason JB & Fox JW (19 91) Synthetic and endogenous ... result of a variety of proteomic and transcriptomic investigations of snake venom and venom glands respectively, numerous databases have been generated that illuminate the complexity of snake...

Ngày tải lên: 18/02/2014, 18:20

... at a concentration of 0.25 mgÆmL )1 Samples were scanned from 19 0 nm to 250 nm and accumulated twice at the resolution of 1. 0 nm with the scanning speed of 50 nmÆ min )1 The cell length was 0 .1 ... different redox potentials at the final concentration of 0.2 mgÆmL )1 In the redox buffer, the ratio (mM/mM) of GSH to GSSG was : 10 , : 5, 10 : 1, 20 : 1, 30 : and 50 : 1, respectively Simultaneously, ... disulfide bonds, of which at least two are non-native The denatured states of HPI under varying concentrations of urea and GdnHCl are shown in Fig With increasing concentration of denaturant, an increasing...

Ngày tải lên: 19/02/2014, 12:20

... analysis of native gels) was investigated (Fig 1) At 31 °C, wild-type MCAD gave the highest level of activity of the three proteins, with 9550 nmol ferriceniumÆmg )1 h )1 (Fig 1A) This increased to 11 ... · 10 3 23.8–24.9 · 10 3 24.6 · 10 3 6 21 19 K364R Direct linear Confidence limits (68%) Wilkinson Standard error 5.38 5.09–5.87 5.67 0 .18 6 25.5 · 10 3 25.4–25.6 · 10 3 25.6 · 10 3 274 19 .8 4552 19 .1 19.9 ... analysis of native PAGE gels, indicative of relative amounts of soluble tetramer No MCAD activity was detected in lysates of cells expressing R256T, but, at both temperatures, the folding of this...

Ngày tải lên: 20/02/2014, 02:21

... formation of [methyl -14 C]5-methylthioribose -1- phosphate from 5¢-[methyl -14 C]MTA [10 ] In all enzymatic assays, the amount of the protein was adjusted so that no more than 10 % of the substrate ... kinetic stability [10 ,12 ], suggesting the involvement of the cysteine pair in the thermal stabilization of both enzymes In the present study, we demonstrate that the CXC motif of SsMTAPII and PfPNP ... less than that of the natural redox reagent glutathione Therefore, this CXC peptide is able to function as an efficient catalyst of disulfide isomerization [26] On the basis of these observations,...

Ngày tải lên: 07/03/2014, 00:20

... maritima 11 9a 11 1a 12 1 10 6 12 2 12 5 17 6 19 5 91 107.5c 85 10 1 10 9 11 0 78 (pH 4)b 95 – 10 4 83 99 266 (30 °C)a,f 0.0041d 279 (30 °C)a,f 0.0033d – – – – 79 (20 °C) – 40 (50 °C) – 63 (10 0 °C) – 31 (25 ... dissociation c lM monomer d kf (s )1) ku (s )1) Thermodynamic model used 5.5 · 10 )5d 2.7 · 10 )4d · 10 )12 · 10 )12 · 10 )4 (pH 10 ) – · 10 )10 (pH 2) – 1. 8 · 10 )7 0. 018 – – – 1. 5 · 10 )7 4.6 · 10 )12 1. 6 · 10 )15 ... 10 )15 · 10 )8 (50 °C) – 1, 1, – – – 1, 1, – 1 1, 1, 1, 1, 1, 1, Final folding ⁄ unfolding step (processes not two-state) FEBS Journal 274 (2007) 4023–4033 ª 2007 The Authors Journal compilation...

Ngày tải lên: 07/03/2014, 05:20

... Journal compilation ª 2008 FEBS C Christis et al 15 0 15 1 15 2 15 3 15 4 15 5 15 6 15 7 15 8 15 9 16 0 16 1 16 2 16 3 chaperones and transient formation of covalent complexes during protein degradation from ... Natl Acad Sci USA 10 0, 86– 91 Ritter C & Helenius A (2000) Recognition of local glycoprotein misfolding by the ER folding sensor 13 7 13 8 13 9 14 0 14 1 14 2 14 3 14 4 14 5 14 6 14 7 14 8 14 9 UDP-glucose:glycoprotein ... compilation ª 2008 FEBS 47 21 Protein folding and oligomerization – ER and cytosol 12 4 12 5 12 6 12 7 12 8 12 9 13 0 13 1 13 2 13 3 13 4 13 5 13 6 4722 C Christis et al may share key structural features with eukaryotic...

Ngày tải lên: 07/03/2014, 06:20

... details of the ‘iron–sulfur switch’ regulating this protein in metazoan cells Experimental procedures Strains and media Strains W303-1B (mat a, ade2 1, ura3 1, his3 11 , trp1 1, leu2–3 ,11 2, can1 10 0), ... yeast implicate its role in iron-mediated redox regulation J Biol Chem 275, 16 227 16 234 11 Kosman DJ (2003) Molecular mechanisms of iron uptake in fungi Mol Microbiol 47, 11 85 11 97 12 Bekri S, ... structure of human iron regulatory protein as cytosolic aconitase Structure 14 , 12 9 13 9 FEBS Journal 274 (2007) 10 83 10 92 ª 2007 The Authors Journal compilation ª 2007 FEBS 10 91 Human IRP1 forms...

Ngày tải lên: 07/03/2014, 10:20

... ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... kcat (s )1) Km (nM) kcat/Km (lM )1 s )1) 44/750 (rhGCPII) 1/ 750 His_44/750 59/750 5.4 8.5 0.80 1. 00 16 0 472 12 7 81 33.7 18 .1 6.6 12 .7 ± ± ± ± 0.3 0.4 0.05 0.04 ± ± ± ± 44 88 47 11 ± ± ± ± 15 .4 5.1...

Ngày tải lên: 07/03/2014, 15:20

... meqa (kJÆmol )1 M )1) [D]50%b DGeqc (kJÆmol )1) WT* P37A P38A SQ QL AA VV S19P 11 .3 11 .9 10 .2 10 .8 10 .4 11 .2 11 .2 10 .0 2.62 2. 21 3.05 2. 21 2.39 2.52 2.22 3 .11 )28.6 )24 .1 )33.2 )24 .1 )26.0 )27.5 ... (± 11 ) 15 ) 11 ) 13 ) 16 ) 27) 11 ) 22) (± (± (± (± (± (± (± (± 58) 94) 12 5) 89) 205) 18 4) 93) 62) Fig Chevron plot analysis of the logarithm of the refolding and unfolding rates vs concentration of ... ¼ 204 Rate constants and m-values are as follows: mUI ¼6992 ± 250 JÆmol )1 M )1, kIN ¼ 468 ± 70 s )1, mIN ¼ 10 01 ± 378 JÆmol )1 M )1, kNI ¼ 0.0034 ± 0.0 011 s )1 and mNI ¼ 310 3 ± 16 8 JÆmol )1 M )1 considered...

Ngày tải lên: 07/03/2014, 16:20

... 25526 26 719 1. 040 1. 018 1. 099 4.98 4.90 5. 51 17.0 17 .6 32.5 1. 0 4.0 27398 274 31 1.002 1. 014 5 .12 4.78 18 .2 21. 0 42 .16 29.24 41. 32 (90%) 30. 31 (10 %) 51. 50 11 0.2 0.6 0.75 1. 0 4.0 37046 2 713 9 26298 ... signal are often seen in the transitions of native structure to molten globule state [3,6,9 ,14 ,15 ,30] Similar is our observation in the case of the equilibrium denaturation/renaturation of s-MDH, ... 26298 28375 1. 003 1. 0 01 1.002 1. 017 5.3 5 .1 4.97 5.02 19 .9 20.2 18 .7 24.6 43.52 32.02 48.25 10 2.4 Equilibrium renaturation %Polyd ˚ Radius (A) [GdnHCl] (M) 36.62 or less constant up to 1. 25 M, which...

Ngày tải lên: 08/03/2014, 23:20

... Biophys J 75, 10 84 10 96 15 Baldwin, R.L (19 96) On-pathway versus off-pathway folding intermediates Fold Des 1, R1–R8 16 Baldwin, R.L (20 01) Folding consensus? Nat Struct Biol 8, 92–94 17 Kim, P.S ... an intermediate state in the unfolding pathway of HSA (Fig 1A) To verify that the intermediate state was indeed a part of the folding Fig Kinetics of secondary structure formation of HSA during ... M, ± 0. 01 M and 1. 5 ± 0 .1 M for h, 12 h and 24 h of refolding, respectively The results together indicated that the stability of the intermediate state decreased with increasing incubation time...

Ngày tải lên: 16/03/2014, 16:20

... His-XHdown (5¢-ATCGTCGGG CTCAGGATCCTTAGTGATGGTGATGGTGATGAGA TGAAGATGAAGCTGAAGA-3¢), for Gas1523-H, or His-XH-Sdown (5¢-GTCGTCGAGCTCAGGATCCTTA GTGATGGTGATGGTGATGATCAACACTACCTGAT GCAGA-3¢), for sGas1482-H ... His-tagged forms sGas1523, sGas1E161Q and sGas1E262Q (B) Representative purification of sGas1523-H Silver staining of the different steps of the purification are shown Lane 1, culture supernatant; lane ... EMBO J 15 , 18 2 19 1 27 Fonzi, W.A (19 99) PHR1 and PHR2 of Candida albicans encode putative glycosidases required for proper cross-linking of beta1,3- and beta -1, 6-glucans J Bacteriol 18 1, 7070–7079...

Ngày tải lên: 16/03/2014, 18:20

... Closed-loop, multiobjective optimisation of analytical instrumentation: gas-chromatography- time -of- flight mass spectrometry of the metabolomes of human serum and of yeast fermentations Anal Chem 2005; 77: ... information into a multitude of cell fates These epigenetic mechanisms are crucial for the function of most, if not all, chromatin-templated processes and link alterations in the chromatin structure ... elucidation of the Type III secretion apparatus (TTSS) common to many Gram-negative pathogens The TTSS allows for the specific injection of bacterial proteins into human host cells, where they mediate...

Ngày tải lên: 16/03/2014, 22:20

... secondary structure 312 12 17 18 19 20 21 22 23 using a simple matrix multiplication Anal Biochem 15 5, 15 516 7 Matulis D & Lovrien R (19 98) 1- Anilino-8-naphthalene sulfonate anion-protein binding ... co-translational pro- FEBS Journal 278 (2 011 ) 295 315 ê 2 010 The Authors Journal compilation ê 2 010 FEBS 313 RNA-dependent conformational states of UDE 50 51 52 53 54 55 56 57 58 59 60 61 62 314 A ... the position of the 208-nm peak (Fig S1) Quantitative evaluation of the CD data is shown in the bar graph FEBS Journal 278 (2 011 ) 295 315 ê 2 010 The Authors Journal compilation ê 2 010 FEBS 299...

Ngày tải lên: 22/03/2014, 16:21

... 2007, 19 , 1 18 [15 ] L Benjamin, G C Benson, J Phys Chem 19 63, 67, 858–8 61 [16 ] S Scheiner, M Cuma, J Am Chem Soc 19 96, 11 8, 15 11 15 21 [17 ] G C Kresheck, H Schneide, H A Scheraga, J Phys Chem 19 65, ... 313 2– 314 4 [18 ] M M Lopez, G I Makhatadze, Biophys Chem 19 98, 74, 11 7 12 5 [19 ] Y Marcus, A Bennaim, J Chem Phys 19 85, 83, 4744–4759 [20] E Wilhelm, R Battino, R J Wilcock, Chem Rev 19 77, 77, 219 –262 ... Biophys J 2000, 79, 51 65 [57] T Ackbarow, X Chen, S Keten, M J Buehler, Proc Natl Acad Sci USA 2007, 10 4, 16 410 16 415 [58] T Erdmann, U S Schwarz, Phys Rev Lett 2004, 92, 10 810 2 10 810 4 [59] E Evans,...

Ngày tải lên: 22/03/2014, 18:20

... treatment —— Grade Q125 38 Couplings and coupling blank protection —— Grades C90, T95, C 110 and Q125 39 10 10 .1 10.2 10 .3 10 .4 10 .5 10 .6 10 .7 10 .8 10 .9 10 .10 10 .11 10 .12 10 .13 10 .14 ... couplings - Groups 1, and 5.2.3 Reference 6.2, Table or Table E.3 7.3.7 7.5.6, A .10 SR16 7.5 .1, A .10 SR16 8.7 8 .10 8 .14 8 .14 9.2 9.9, A.8 SR13 10 .3 11 12 .1 13.2, A.9 SR15 Annex H 9.2 A .12 SR38 9.7 9.8 ... Grades P 110 and Q125 Alternative F factor for statistical impact testing Special end-finish for casing, couplings or pup joints 10 .12 .3 10 .12 .2 10 .15 , A.2 SR1, A.3 SR2, A.5 SR10 and A.6 SR 11 11 12.2...

Ngày tải lên: 23/03/2014, 00:20

... detection system 14 15 16 17 18 19 20 21 22 F Forneris et al spectrometry, thermal shift (ThermoFluor) assay, and multiangle or static light scattering Methods Mol Biol 426, 299– 318 Lo MC, Aulabaugh ... measurements of ellipticity at 222 nm in the temperature range 25–70 °C with a constant heating rate of °CÆmin )1 LSD1 ⁄ CoREST reconstitution and inhibition assays Human LSD1, mgÆmL )1 in 50 mm ... Amicon concentrator (Millipore Corp., Billerica, MA, USA) with a 30 kDa cutoff to a final concentration of 20 mgÆmL )1 A set of 15 buffers at 50 mm concentration in the pH range 4.2 10 .6 was prepared...

Ngày tải lên: 23/03/2014, 04:21

... Jahn and S E Radford 10 11 12 13 14 15 16 17 18 19 20 21 22 23 of the protein topology universe Trends Biochem Sci 30, 13 19 Vendruscolo M, Paci E, Dobson CM & Karplus M (20 01) Three key residues ... relative free energies of partially folded states of proteins Proc Natl Acad Sci USA 10 0, 14 817 14 8 21 Bollen YJ, Sanchez IE & van Mierlo CP (2004) Formation of on- and off-pathway intermediates ... weak hydrophobic environment of a chaperonin cavity: creation of an alternate fast folding pathway Proc Natl Acad Sci USA 10 1, 13 192 13 197 61 Sekijima Y, Wiseman RL, Matteson J, Hammarstrom P, Miller...

Ngày tải lên: 23/03/2014, 11:20