0

there s a new kid in town

Báo cáo y học:

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

Y học thưởng thức

... served as controls for the same time periods The cell viability was assessed by a dye exclusion assay with trypan blue staining (0.4%) for minutes This dye exclusion assay is useful for a quick ... determination of the distribution of grey-values and differential relaxation times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are ... results and radiation exposure Requirements for successful intracellular imaging with MRT are a perspicuous signal and a sufficient accumulation of contrast agent (CA) within the target cells There...
  • 11
  • 655
  • 0
CHAPTER ELEVEN MIND MAPPING   a NEW DIMENSION IN THINKING AND NOTE TAKING

CHAPTER ELEVEN MIND MAPPING a NEW DIMENSION IN THINKING AND NOTE TAKING

Kỹ năng thuyết trình

... There are human crickets who must eat their own hearts in order to sing Key words or phrases for main and secondary ideas from Kusa-Hibari main secondary paragraph paragraph paragraph paragraph paragraph ... eggs hatched in a jar of clay, in the shop of some insect-merchant: and they dwelt thereafter only in cages But he sings the song of his race as it was sung a myriad years ago, and as faultlessly ... Numbers d Letters e Images f Colours g Dimension h Outlining On page 109 is a Mind Map summarising a three-day Brain Training and Mind Mapping Course The Mind Map was made by a father who was also...
  • 52
  • 671
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

Báo cáo khoa học

... contained 10K utterances We separated these utterances into two parts randomly: 5K as the adaptation corpus and 5K as the testing set We show the ASR character accuracy results after lexicon adaptation ... Since all the above statistics of all possible character sequences in a raw corpus are combinatorially too many, we need an efficient data structure such as the PAT-tree to record and access all such ... mutual information between 4.2 ASR Character Accuracy Results A set of broadcast news corpus collected from a Chinese radio station from January to September, 2001 was used as the speech corpus...
  • 9
  • 466
  • 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx

Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx

Báo cáo khoa học

... Thesis, Instituto ¸ ˜o ´ de Ciencias Biomedicas Abel Salazar, University of Porto, ˆ Portugal Sudo, S. , Fujikawa, T., Nagakura, T., Ohkubo, T., Sakaguchi, K., Tanaka, M., Nakashina, K & Takahashi, ... two peaks contained acidic proteins Nevertheless, they were aspartic-rich in EDTA-SM whilst being quite glutamic acidrich in WSM Glycosaminoglycan analysis Glycosaminoglycans are highly negatively ... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated...
  • 10
  • 731
  • 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc

Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc

Khoa học xã hội

... States, he was assigned to temporary duty at West Point awaiting the long delayed passage of an act authorizing the enlistment of a company of U S Engineer soldiers That act was passed soon after ... engineer company was principally engaged in assisting engineer officers in making surveys of the fortifications and surrounding ground, in dismantling our own batteries, magazines, &c.; and aiding ... and cannon balls close about our heads This fire was soon understood to come from our Naval gunboats, and aimed at small parties of Mexican lookouts on shore No resistance was made to the landing...
  • 48
  • 504
  • 0
scientific american   -  2002 06  -  spintronics  -  a new twist in computing

scientific american - 2002 06 - spintronics - a new twist in computing

Toán học

... who is gearing up to lead phase I tests of a clade C–based vaccine in Botswana later this year, argues that unless researchers are sure that a vaccine designed against one clade can cross-react ... candidate AIDS vaccine must successfully pass through three stages of human testing In phase I, researchers administer the vaccine to dozens of people to assess its safety and to establish an ... difference being that its value must be positive (at least in classical physics) Masses attract other masses via a “gravitoelectric” field Moving masses exert forces on moving masses via a “gravitomagnetic”...
  • 87
  • 798
  • 0
a new dataset in the making

a new dataset in the making

Hóa học - Dầu khí

... objective in this design category is to list types of non-trade issues that are addressed in PTAs We focus on issues that are normally regulated in international legal instruments other than classical ... experts in the field, mainly economists and trade lawyers, as well as previous articles that address similar topics A list of papers that we used as base to our coding scheme is included in Table ... 198 0s Europe Asia Africa America Oceania Cross Region Europe Asia Africa America Oceania Cross Region Figures 1 9a- 19d: Provisions on technical barriers to trade (TBT) and sanitary and phytosanitary...
  • 47
  • 414
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc

Điện - Điện tử

... Alicaforsen (ISIS 2302) ISIS Pharmaceuticals ISIS Genta ISIS CMV IE2 PKC-α Bcl2 ICAM-1 PS DNA PS DNA PS DNA PS DNA Approved in 1998 Phase III Phase III Phase II/III ISIS 14803 ISIS 2503 MG98 ISIS ... ISIS ISIS Methylgene PS DNA PS DNA PS DNA Phase II Phase II Phase II EPI-2010 Asthma PS DNA Phase II GTI 2040 EpiGenesis Pharmaceuticals Lorus Therapeutics Cancer PS DNA Phase II ISIS 104838 Avi4126 ... Biogen, Inc (Massachusetts) OraSure Technologies, Inc CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals...
  • 6
  • 568
  • 0
báo cáo hóa học:

báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc

Hóa học - Dầu khí

... first regression analysis at t-1 was used as additional covariate The last analysis was focused on the association between health factors and participation This result has to be taken into account ... (MBI-D) from Büssing and Perrar [24] The main focus at baseline assessment was on subjective need This was addressed by a single question "Do you intend to participate in a coaching course currently ... occupational history and self-rating scales With this questionnaire data on family background (having children, marital status) was obtained for reasons of adjustment Part-time work was arbitrarily...
  • 10
  • 367
  • 0
báo cáo hóa học:

báo cáo hóa học:" Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" pdf

Hóa học - Dầu khí

... Alicaforsen (ISIS 2302) ISIS Pharmaceuticals ISIS Genta ISIS CMV IE2 PKC-α Bcl2 ICAM-1 PS DNA PS DNA PS DNA PS DNA Approved in 1998 Phase III Phase III Phase II/III ISIS 14803 ISIS 2503 MG98 ISIS ... ISIS ISIS Methylgene PS DNA PS DNA PS DNA Phase II Phase II Phase II EPI-2010 Asthma PS DNA Phase II GTI 2040 EpiGenesis Pharmaceuticals Lorus Therapeutics Cancer PS DNA Phase II ISIS 104838 Avi4126 ... Biogen, Inc (Massachusetts) OraSure Technologies, Inc CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals...
  • 6
  • 561
  • 0
Desiccant enhanced evaporative air-conditioning (DEVap): evaluation of a new concept in ultra efficient air conditioning docx

Desiccant enhanced evaporative air-conditioning (DEVap): evaluation of a new concept in ultra efficient air conditioning docx

Năng lượng

... prices, especially if its use increases significantly during the summer in residential applications In most cases, the cost comparison using the best available data today shows that the DEVap air ... natural gas prices, the LCCs for DEVap are less than for DX A/ C in most cities The costs of the two systems in many locations are approximately the same given uncertainties in this analysis Assuming ... more readily addressed during building design Desiccant systems primarily use plastics in the design and could pose issues to satisfy regional codes Many similar products, namely the DAIS ConsERV...
  • 61
  • 423
  • 0
There''''s a message for you ppsx

There''''s a message for you ppsx

Anh ngữ phổ thông

... excellent qualifications Yours sincerely, Anne Lee Thông thường ta viết Yours faithfully bạn viết cho Dear Sir or Madam Please consider me for an interview I have excellent qualifications Yours faithfully, ... dã cho children kids The kids go to bed at eight o’clock ANNE You must have been there a hundred times STEVE Not since I was a kid It was great Trẻ v a biết gọi toddlers Things get more difficult ... viết hoa: Dear Please consider me for an interview I have excellent qualifications Nếu tên người bạn viết thư cho, viết Sir or Madam Dear Sir or Madam Please consider me for an interview I have...
  • 8
  • 229
  • 0
Báo cáo y học:

Báo cáo y học: "Human depression: a new approach in quantitative psychiatry" pdf

Báo cáo khoa học

... example, activation of adenylate cyclase) The Gα subunit is activated and starts a cAMP signalling cascade, as shown in Figure The international scientific literature has reported abnormalities ... implicated in neurological and psychiatric diseases [26] Raft localisation of Gsα in human peripheral tissue (possibly platelets, see [15]) may thus serve as a biomarker for depression Several studies ... collection and data analysis All authors were involved in the interpretation of the data All the authors have been involved in drafting and revising the manuscript and have read and approved the final...
  • 6
  • 435
  • 0
Báo cáo y học:

Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

Báo cáo khoa học

... animal models can be used to assess the role of several pathogenic factors at various stages of disease, and thus may serve as a sophisticated tool with which to study the relevance of individual ... these compounds in animal models Nevertheless, various chemokines and chemokine receptors have been targeted successfully in animal models of arthritis Studies using this approach suggest that ... reported in the near future Competing interests Conclusion The available data in animal models and initial data in human disease suggest that chemokine family members might be attractive targets for...
  • 5
  • 460
  • 0
Báo cáo y học:

Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx

Báo cáo khoa học

... References Takei S, Hoshino T, Matsunaga K, Sakazaki Y, Sawada M, Oda H, Takenaka S- I, Imaoka H, Kinoshita T, Honda S, Ida S, Fukuda T -A, Aizawa H: Soluble interleukin-18 receptor complex is a novel ... Interestingly, IL-18 protein expression in synovial tissue did correlate with serum CRP and disease activity in inflammatory arthritis [12], indicating a local role in the pathophysiology of disease A ... diagnosis and the soluble IL-18Rα complex may be useful in this regard for RA, but longitudinal studies and crosssectional analysis are warranted Abbreviations CRP, C-reactive protein; IL, interleukin;...
  • 3
  • 294
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt

Báo cáo khoa học

... cellular and a syncytial trophophoblast layer separating maternal and fetal blood spaces (maternal lacuna, ml, and fetal vessels, fv) All of these characterize the definitive labyrinthine placenta ... Lepus americanus, Lepus europaeus and Lepus starcki; genus Sylvilagus: Sylvilagus brasiliensis, Sylvilagus floridanus) The domestic rabbit, Oryctolagus cuniculus, analyzed in this study, belongs ... sec at 50°C, at 68°C) The primers used were: 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal...
  • 11
  • 354
  • 0
Báo cáo y học:

Báo cáo y học: "Bench-to-bedside review: Circulating microparticles - a new player in sepsis" ppt

Báo cáo khoa học

... sepsis In the defence against pathogens, haemostasis is as fundamentally important as innate immunity and complement-mediated cell lysis Haemostasis is activated during sepsis and septic shock, ... ligands, such as urokinase plasminogen activator, plasminogen and metalloproteases MMP-2 and -5, suggesting a role in fibrinolysis and in local tissue remodelling [30,34,35] MPs may also display ... present in various in ammatory diseases, including sepsis [7] MPs are a source of phospholipids, a substrate for phospholipase A2 , which facilitates platelet aggregation [38,39]; they may also...
  • 8
  • 327
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25