the three point bending of a sandwich panel

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

... reverse CCC AGG TTG AAT AGT GAA CAG ACG GGC TGG CTC AGG CAG TCT CCT ATG TTC AGA TGG GCC TTC GCC TCC GG GTC CTG ATC CTG CTC CTA CCC GGG CCC GGG CCC GGG CAG GAC CAG GAT TAG GAG TAA GTG CAA GTC CAA GTC ... Fig 1) Based on the above comparisons, it appears that all three FlgCK domains have the requisite elements for catalysis and are at least capable of the same types of structural interactions ... multiple catalytic domains have been identified – two-domain arginine kinases [19–21], a two-domain carbonic anhydrase [22], a three- domain luciferase [23] and a threedomain adenylate kinase [24] The...

Ngày tải lên: 16/03/2014, 06:20

9 569 0
Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt

Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt

... classification of cellulases Eur J Biochem 258, 200–206 68 Takashima, S., Iikura, H., Nakamura, A. , Hidaka, M., Masaki, H & Uozumi, T (1998) Isolation of the gene and characterization of the enzymatic ... white against a black background are amino acids that are identical or have a conserved substitution in all five sequences Residues in white against a grey background are amino acids that are identical ... interactions were 0.6 per 100 residues, a- carbon tetrahedral distortion was 1.8°, the standard deviation of the hydrogen bond energies was 0.7 and overall G-factor, a measure of the normality of the...

Ngày tải lên: 23/03/2014, 13:20

12 554 0
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

... structural data are available MATERIALS AND METHODS Building the 3D model of PMA1_NEUCR In our approach, the model of PMA1_NEUCR was built using the ATC1_RABIT crystal structure as template by ... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to the ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol...

Ngày tải lên: 23/03/2014, 21:20

13 514 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

... Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RNspaces J Nonlinear Sci Appl 4, 110–119 ... equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis ... using the fixed point alternative approach, we prove the Hyers-Ulam stability of the functional equation (1) in fuzzy normed spaces In the rest of the article, assume that X is a vector space and...

Ngày tải lên: 20/06/2014, 22:20

14 480 0
Báo cáo hóa học: " Positive solutions of the three-point boundary value problem for fractional-order differential equations with an advanced argument" ppt

Báo cáo hóa học: " Positive solutions of the three-point boundary value problem for fractional-order differential equations with an advanced argument" ppt

... Srivastava HM, Trujillo JJ: Theory and Applications of Fractional Differential Equations In North-Holland Mathematics Studies Volume 204 Elsevier, Amsterdam; 2006 Sabatier J, Agrawal OP, Machado ... J: Theory of Fractional Dynamic Systems Cambridge Academic Publishers, Cambridge; 2009 Lakshmikantham V, Vatsala AS: Basic theory of fractional differential equations Nonlin-ear Anal 2008, 69(8):2677-2682 ... solutions of a nonlinear three- point boundary value problem Electron J Differ Equ 1998, 34:1-8 Marano SA: A remark on a second order three- point boundary value problem J Math Anal Appl 1994,...

Ngày tải lên: 21/06/2014, 03:20

11 343 0
Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx

Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx

... et al other Listeria spp are classified to A, B, C, or D type flagella antigen; but L grayi only have the E type flagella antigen [1] According to the report by Vatanyoopaisarn et al [22], attachment ... method that has nearly same sensitivity as × 104 to 105 bacteria ml−1 [4], the detection limit of the sandwich ELISA using Pair1 antibodies, the combination of HRP labeled MAb 7A3 and MAb 2B1 coated ... hundred ml of each optimally diluted MAb 7A3 and IgY labeled HRP was added into each well of the plates The plates were incubated for 30 at RT and washed three times with PBS Antigen-antibody reaction...

Ngày tải lên: 07/08/2014, 18:21

6 388 0
báo cáo khoa học: " The first three-dimensional visualization of a thrombus in transit trapped between the leads of a permanent dual-chamber pacemaker: a case report" docx

báo cáo khoa học: " The first three-dimensional visualization of a thrombus in transit trapped between the leads of a permanent dual-chamber pacemaker: a case report" docx

... interpreted patient data regarding the cardiac disease and was a major contributor in writing the manuscript PM performed the transthoracic echocardiography PM, TB and MP performed the transthoracal and ... the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Maagh et al Journal of ... thrombolysis are known to reduce the size of the thrombi present in the cardiac and pulmonary vascula- Page of ture, but they also increase the risk of fragmentation which can lead to further embolization...

Ngày tải lên: 11/08/2014, 02:22

4 290 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... modeled The simulator runs until all clean segments are exhausted, then simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator was...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

... performance and thermal characteristics of the system Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar desalination system is a combination of evaporative-condenser ... is refined latent heat of vaporization of water at the condenser surface of last stage (J/kg), h fgNs is latent heat of vaporization of water at the condenser surface of the last stage (J/kg), ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged...

Ngày tải lên: 05/09/2013, 16:11

26 568 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language...

Ngày tải lên: 07/09/2013, 13:48

39 827 2
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... Subject The spaceship The planet They There The spaceship The two astronauts The woman It She We It Both of them They All plants and Animals They They Everything The man Nothing Something He I The...

Ngày tải lên: 12/02/2014, 20:20

18 714 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... another single-domain phytase may improve the catalytic efficiency of the latter Materials and methods Strains, plasmids and chemicals E coli Trans1-T1 (TransGen, Beijing, China) and pGEM-T Easy ... sum of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

... the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation ... as a one of the attached maps Every person that wished to use joint Jordanian-Palestinian delegation Although bilateral safe passage had to carry a safe passage card or a safe and multilateral ... 1948, Dhaka and Urdu were declared West Bank might claim that the Bangladesh Liberation the of cial languages of all of Pakistan This proved War and the secession of East Pakistan was the result...

Ngày tải lên: 16/02/2014, 11:20

64 307 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... because these are the most distant pair of haems in the structure and are therefore expected to have the weakest interaction [33] The pH dependence of the chemical shifts of the NMR signals of the ... that the spectra are very similar with respect to chemical shifts of the signals in intermediate stages of oxidation, and that formation of the complex does not lead to a marked decrease of the...

Ngày tải lên: 19/02/2014, 17:20

10 640 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

... data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade to pull, the ... system must allocate additional threads to allow the application to make progress while the I/O Facade task is blocked However, 2: Demarshaled data adding threads to the system has many negative consequences, ... guaranteed that its deadline will be met, based on the published parameters of each schedulable operation One advantage of our approach is that operation invocations only pay the overhead of the C++...

Ngày tải lên: 19/02/2014, 18:20

20 738 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful ... aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases,...

Ngày tải lên: 21/02/2014, 03:20

7 603 0
Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

... Annals of Mathematics, 159 (2004), 1247–1274 Numerical characterization of the K¨hler cone of a compact K¨hler manifold a a By Jean-Pierre Demailly and Mihai Paun Abstract The goal of this ... there exists a very neat characterization of nef classes on arbitrary surfaces, K¨hler or not a The Main Theorem has an important application to the deformation theory of compact K¨hler manifolds, ... can also view this fact as a characterization of the dual cone of the nef cone, in the space of real cohomology classes of type (n − 1, n − 1) This leads immediately to Corollary 0.4 In the case...

Ngày tải lên: 05/03/2014, 23:20

29 468 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... that factor Xa cleaved and activated proHP8Xa When activated HP8Xa was mixed with proSpatzle¨ 1A, the 38 kDa pro-Spatzle band disappeared, and a ¨ 12 kDa product was produced (Fig 7A) N-terminal ... analysis using antiserum against M sexta HP8 Bands representing the proHP8Xa zymogen, a truncated form of proHP8Xa and the catalytic domain of active HP8 are marked with arrowheads The size and ... exchange chromatography SDS ⁄ PAGE analysis in the presence of b-mercaptoethanol indicated that the purified Spatzle had an ¨ apparent molecular mass of 38 kDa, which is slightly larger than that...

Ngày tải lên: 06/03/2014, 09:22

15 541 0
w