the thermopower of a quantum dot coupled to luttinger liquid system

... medical ICU of the author's hospital YHS is a registrar in the division of respiratory and critical care of the author's hospital DP is a research assistant CYH is the head of the biostatistics ... proximal to the reservoir towards the patient's end is then closed The sample site is cleaned and a syringe with a custom-made cannula (Edwards Lifesciences) is attached A vacuum tube is attached to ... hospital LTK is the head of the division of respiratory and critical care medicine of the author's hospital PL is the nurse clinician of the medical ICU of the author's hospital Acknowledgements The...

Ngày tải lên: 13/08/2014, 20:21

... ranked among top 12 biggest banks and asset ranked among 20 biggest banks out of 44 Vietnam banks - Its performance (ROA) ranked among top 20 banks Secondary information and data of the bank includes ... investors cannot find this information easily One of the main shareholders of the bank has borrowed from the bank a loan which has value far exceeding its shares at the bank This kind of information ... The bank has procedure for selecting external auditor 57 The bank has policy to change external auditor 58 The bank actually changes external auditors at least every years VIOLATIONS 59 There is...

Ngày tải lên: 02/01/2015, 17:33

... of subband error The two mechanisms facilitate the significant normalization of subband data and a quantization scheme design with linear distortion characteristics EURASIP Journal on Advances ... performance Several experiments are also taken by using the MIT-BIH arrhythmia database [13] The rest of this paper is organized as follows The nonlinear quantization scheme with the approximate ... scheme, the hardware cost of realizing the RRO-NRDPWT-based ECG data compression system can be dramatically reduced References [1] R Nygaard, G Melnikov, and A K Katsaggelos, A rate distortion...

Ngày tải lên: 21/06/2014, 05:20

... stalled at R-factors of 26 and 30% This may be due to real disorder in the crystal as the mean B-factor from the refinement was rather high ˚ ˚ (78.5 A2 ) – as was the Wilson B-factor (77 A2 ) It should ... Fcalc|)/( |Fobs|), where Fobs and Fcalc are observed and calculated structure factor amplitudes, respectively Rfree is an R-factor for an unrefined subset of the data (5% of the data) a the metal ... an artifact, it is apparently strong enough to appear in the crystal and adjust the enzyme in an induced-fit-like manner: the conformation of the flap domain changes, M3 metal is introduced and Arg13...

Ngày tải lên: 07/03/2014, 09:20

... have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar to ... and other parameters related to the customer, whereas the role of the employees, their satisfaction, loyalty and the link between these variables and profitability is not often included in marketing...

Ngày tải lên: 20/12/2013, 17:15

... Irizar Brazil and Irizar Mexico, with a shareholding in International Hispacold, all to be able to service the growing demand in these markets At the same time, a systematic application of KM was ... success factors are valid for any type of strategy It is possible that the quality of the strategy established in a firm can be measured via these same factors, even if the individual case is a strategy ... and KM systems and tools The knowledge management strategy developed at Irizar At Irizar, it is understood that the objective of KM is the promotion of innovation and the capacity of the organization...

Ngày tải lên: 24/01/2014, 00:20

... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...

Ngày tải lên: 26/01/2014, 10:20

... Experimental procedures, the rate of assimilate export from photosynthetically active source organs to consuming sink organs or metabolic pathways other than carbohydrate pathways was calculated as the ... T, Sawodny O, Ederer M & Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase ... identification and simulation A mathematical model was developed, representing central carbohydrate metabolism in leaves of A thaliana The model was based on the following system of ordinary differential...

Ngày tải lên: 14/02/2014, 22:20

... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... more rapid turnover The kcat ⁄ Km values increase from G1P over PhyK to AppA by a factor of  2200 The conformational changes of AppA upon substrate binding facilitate a faster turnover of phytate ... Approximately 70% of the model was built automatically After extending the Mse data to a resolution of ˚ 2.04 A, resolve built 76% of the protein model automatically The Mse–PhyK structure was...

Ngày tải lên: 16/02/2014, 09:20

... relationships between AFQT and years of experience or additional training are linear Rather, the authors note that although the magnitude of the trade-off may vary, it is at least one -to- one and ... did any of the other variables In an effort to quantify the effect of AFQT on performance in their model, the authors note that the effect of a one-level change in AFQT category appeared to equal ... surpass the effect of an additional year of operator experience as well as the performance effect of additional simulation training This observation is not meant to imply that the trade-offs...

Ngày tải lên: 17/02/2014, 22:20

... [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... the narrow substrate specificity and the cofactor References Hasegawa, Y., Muraki, T., Tokuyama, T., Iwaki, H., Tatsuno, M & Lau, P.C (2000) A novel degradative pathway of 2-nitorobenzoate via ... nm The typical protein absorption peak of 280 nm shifts to 265 nm if the protein contains a flavin-type cofactor [28] We failed to identify the cofactor of the deaminase from strain 10d because...

Ngày tải lên: 19/02/2014, 16:20

... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... consider the totals (e.g from the national accounts) as sacrosanct and break these down Since national accounts have to become available soon after the end of the year to which they refer, they are ... accounts totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative...

Ngày tải lên: 06/03/2014, 21:20

... sure to research these features before disabling or modifying them The AutoRun feature in Microsoft Windows systems was a default feature at the time of the Conficker malware and was one of the ... automatic updating Enable that feature so your software always has the most current signatures If automatic updates aren’t offered, be sure to install the software from a reputable source, like the vendor’s ... daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware programs offer automatic...

Ngày tải lên: 14/03/2014, 22:20

... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation of surface waters with respect to aragonite ... dedicated to the furtherance of science and technology and to their use for the general welfare Upon the authority of the charter granted to it by the Congress in 1863, the Academy has a mandate...

Ngày tải lên: 15/03/2014, 15:20

... b1fi2Mana1fi2Mana1fi2 a1 fi3Mana1fi2Mana1fi2Mana1fi2 ›6 Mana1 Mana1fi3 a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > > ›2 ›2 ›2 > > = Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > ›2 > > > a1 fi2Mana1 ; a1 fi6Mana1fi6Mana1fi6Mana1fi6 ... a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 ›2 ›2 a1 fi2Mana1 Mana1fi2 Mana1fi6 a1 fi6Mana1fi6 a1 fi3Mana1fi2 Manb1fi2Mana1fi3 Manb1fi2Manb1fi2Mana1fi3 Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2 ... a b Residue Signal dimension (%) Manb1fi2Mana1fiphosphate Manb1fi2Manb1fi2Mana1fiphosphate a1 fi2Mana1fi3Mana1fi2 a1 fi3Mana1fi2Mana1fi3Mana1fi2 ›6 ›6 Mana1 Mana1 Mana1fi2Mana1fi2 a1 fi2Mana1fi2Mana1fi2 b1fi2Mana1fi2Mana1fi2...

Ngày tải lên: 17/03/2014, 03:20

... (Iwatani, Fukuoka, Japan) All other chemicals used were of analytical grade Formation of a- hydroxyhaem-rHO-1 complex Scheme The resonance structure of a- hydroxyhaem Unless otherwise stated, the ... out as follows; a portion of the rHO-1 solution was transferred to a custom-made anaerobic titrator [24], that contained % mL of the buffer Then a- hydroxyhaemin dissolved in a small amount of ... disappeared, indicates the formation and degradation of a trace amount of the CO-ferrous verdohaem produced from the free a- hydroxyhaem Acidification and extraction of the product into chloroform gave biliverdin,...

Ngày tải lên: 23/03/2014, 21:20

... reported that they preferred a female doctor to take their Pap smear, 48% that they preferred a woman for their breast exam and 36% that they preferred a woman to take a sample of vaginal fluid ... and contingency tables were formed on the questioned variables The x2 test was used on the qualitative variables and the t-test on the quantitative variables From the total of the examined variables, ... presence of the female researchers, to whom the participants could ask explanatory questions The questionnaire was created The preference of a Female Greek island population in regard to the gender of...

Ngày tải lên: 28/03/2014, 14:20

... public A story is told that once he was to play his C major Concerto at a concert When he arrived at the hall he found the piano was tuned so low that he had to play the Concerto in C# major You ... expense to the user, provide a copy, a means of exporting a copy, or a means of obtaining a copy upon request, of the work in its original "Plain Vanilla ASCII" or other form Any alternate format ... of certain implied warranties or the exclusion or limitation of certain types of damages If any disclaimer or limitation set forth in this agreement violates the law of the state applicable to...

Ngày tải lên: 30/03/2014, 00:20

... AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT ... AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC ... AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA...

Ngày tải lên: 30/03/2014, 11:20

... human cells J Cell Sci 108, 635–644 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors ... 5¢-CATGAACCGGTTTGGTAC-3¢ as the 5¢ primer, and C, 5¢-CTATCCCACGGTGACAA AGC-3¢ as the 3¢ primer The sequence between these primers was amplified by PCR using Ex Taq DNA polymerase (Takara, Tokyo, ... that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein ZAN75: nuclear...

Ngày tải lên: 30/03/2014, 20:20