the standard form of a journal entry has the

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Ngày tải lên : 16/03/2014, 13:20
... DosH as a template and using the following respective 5Â-sense primers: 5Â-gatga gtcgggagACCcagctggagaaaaaag-3Â,5Â-gatgagtcgggagTTTcag ctggagaaaaaag-3Â,5Â-ggacccgttttgcgACCtcgaaagtgagc-3Â, and ... data based on our data and that of others have accuracies of % 3–5 mV. Even taking the accuracy into consideration, redox poten- tials of Ec DosH proteins have an apparent hysteresis in the data, ... decreased the rate of auto-oxidation [5], whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water mole- cules with the proximal ligand His77, markedly increased...
  • 14
  • 390
  • 0
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

Ngày tải lên : 23/03/2014, 10:20
... spectro- photometrically in the ultrafiltrates on the basis of the absorbance at 223 nm. The number of HNE covalent adducts ⁄ equivalent of OBP was finally calculated by sub- tracting the values determined in the ... of OBP against HNE cytotoxicity in a simplified model simulating the nasal epithelium The aim of this experiment was a preliminary evalua- tion of the protective role of OBP against chemical aggression ... OBP. The purification of the protein was obtained by affinity chroma- tography with a Ni-NTA Agarose (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The aggregation state was...
  • 12
  • 386
  • 0
Báo cáo khoa học: Mapping the binding domains of the aIIb subunit A study performed on the activated form of the platelet integrin aIIbb3 pot

Báo cáo khoa học: Mapping the binding domains of the aIIb subunit A study performed on the activated form of the platelet integrin aIIbb3 pot

Ngày tải lên : 31/03/2014, 07:20
... functions, has led to extensive research in the development of small RGD-containing peptides as anti- thrombotic agents. Elucidation of the pharmacophoric nature of the Asp and Arg side-chains allowed ... with the binding of PAC-1 to the activated form of a IIb b 3 . Furthermore, a IIb 313–332 was found to bind to fibrinogen in a solid-phase binding assay. It should be emphasized that all the experiments ... but also for platelet activation. The rationale of this study was based on the assumption that peptide fragments derived from the a IIb subunit could act as inhibitors of platelet aggregation...
  • 8
  • 499
  • 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Ngày tải lên : 08/03/2014, 09:20
... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway. The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained ... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented in panel (A) , after correction for translation ... depleted of 4.5S RNA. After radioactive labeling of the cells, the PhoE forms were immunoprecipitated and analyzed by SDS/PAGE (Fig. 5). Depletion of 4.5S RNA did not result in the accumulation of...
  • 8
  • 546
  • 0
Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot

Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot

Ngày tải lên : 28/03/2014, 23:20
... 2007. Atención de la salud a través de las distintas épocas NiñezInfancia Neonatal Posnatal Embarazo Adolescencia Preembarazo Posparto Salud materna PARTO 21 Un balance sobre la mortalidad materna ASIA ... la familia. En cambio, una mejor salud materna puede reducir la pobreza (ODM 1), al ahorrar a la familia las desastrosas consecuencias económicas que acarrea su muerte o discapacidad. La asistencia ... desventajosa condición social, política y económica de la mujer en muchas sociedades. Las tasas más altas de mortalidad materna se registran en países de África subsahariana y Asia meridional Tasas...
  • 48
  • 417
  • 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Ngày tải lên : 30/03/2014, 15:20
... has a cata- lytic rather than just a substrate binding role. Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization of the anion transition ... hypothesis that the keto intermediate has a cis rather than trans geometry is based on the observation that the enzyme cannot hydrate the trans-keto form of HPDA that is spontane- ously formed in aqueous ... k cat and not the K m values in the BphH hydration of HPDA, suggest- ing that cation has a catalytic rather than just a substrate binding role. BphH is able to transform alternative substrates...
  • 9
  • 461
  • 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Ngày tải lên : 31/03/2014, 09:20
... conrmed the strong UDP-GalNAc:Fuca1,2GalaGalNAc transferase (A transferase) activity of the enzyme product and allowed detection of a small UDP-Gal:Fuca1,2GalaGal transferase (B transferase) activity. ... Amplification of the cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA. Amplification was performed using the Advantage ... activity. The presence of the mRNA and of the A and B antigens was searched in various BDIX rat tissues. There was a general good concordance between the presence of the mRNA and that of the A antigen....
  • 8
  • 499
  • 0
Tài liệu Báo cáo khoa học: Bioimaging of the unbalanced expression of microRNA9 and microRNA9* during the neuronal differentiation of P19 cells doc

Tài liệu Báo cáo khoa học: Bioimaging of the unbalanced expression of microRNA9 and microRNA9* during the neuronal differentiation of P19 cells doc

Ngày tải lên : 18/02/2014, 17:20
... CAG CAC CTC Amplify N1–N5 promoter fragments Perfect target seq. of miR9 sense TCGAGAATCTAGT TCA TAC AGC TAG ATA ACC AAA GA TAGTA TCA TAC AGC TAG ATA ACC AAA GA TAGTA TCA TAC AGC TAG ATA ACC AAA ... TTAT Construction of CMV ⁄ Gluc ⁄ 3xPT_mir9* Perfect target seq. of miR9* anti-sense CTA GAT AAA GCT AGA TAA TTG AAA GT TACTA TAA AGC TAG ATA ACC GAA AGT TACTA TAA ACG TAC ATA ACC GAA AGT ACTAGATTC Construction ... expression of pri-miR9-3 MAP2 forward CCC AAG AAC CAA CAA GAT GAA RT-PCR for neuronal differentiation MAP2 reverse AAT CAA GGC AAG ACA TAG CGA RT-PCR for neuronal differentiation b-actin forward TGA CGG...
  • 12
  • 612
  • 0
Trends in the European Investment Fund Industry in the Second Quarter of 2011 and Results for the First Half of 2011 potx

Trends in the European Investment Fund Industry in the Second Quarter of 2011 and Results for the First Half of 2011 potx

Ngày tải lên : 07/03/2014, 16:20
... release and other statistical releases are available on efama’s website (www.efama.org) Trends in the European Investment Fund Industry in the Second Quarter of 2011 ... and Results for the First Half of 2011 This report was prepared by Bernard Delbecque, Director of Economics and Research EFAMA The European Fund and Asset Management Association ... reflects the change in investor confidence from a high level at the beginning of 2010 to lower levels in 2011, when a constant stream of events from the Arab uprisings and the Japanese earthquake,...
  • 8
  • 637
  • 0
Trends in the European Investment Fund Industry in the Second Quarter of 2012 and Results for the First Half of 2012 pdf

Trends in the European Investment Fund Industry in the Second Quarter of 2012 and Results for the First Half of 2012 pdf

Ngày tải lên : 07/03/2014, 16:20
... release and other statistical releases are available on efama’s website (www.efama.org) Trends in the European Investment Fund Industry in the Second Quarter of 2012 ... and Results for the First Half of 2012 This report was prepared by Bernard Delbecque, Director of Economics and Research EFAMA The European Fund and Asset Management Association ... market funds also enjoyed a modest increase in net assets of 0.9 percent. On the other hand, equity funds registered a decrease in net assets during the quarter (4.1%), and net assets of balanced...
  • 8
  • 663
  • 0
Báo cáo khoa học: The role of ADAM10 and ADAM17 in the ectodomain shedding of angiotensin converting enzyme and the amyloid precursor protein ppt

Báo cáo khoa học: The role of ADAM10 and ADAM17 in the ectodomain shedding of angiotensin converting enzyme and the amyloid precursor protein ppt

Ngày tải lên : 30/03/2014, 14:20
... cycles. ADAM17 PCR primers: 5Â-GAAGAAGTGCCAGGAG GCGATT-3Â,5Â-CGGGCACTCACTGCTATTACCT-3Â and the uorescent probe 5Â-ATGCTACTTGCAAA GGCGTGTCCTACTGC-3Â, ADAM10 primers: 5Â-TCC ACAGCCCATTCAGCAA-3Â,5Â-GCGTCTCAGTGGT CCCATTTG-3Â ... compound 4-aminophenylmercuric acetate (APMA) stimulated the shedding of ACE but not of APP. The APMA-stimulated secretase cleaved ACE at the same Arg-Ser bond in the juxtamembrane stalk as the constitutive secretase but ... shedding of APP upon incubation of the cells with APMA, the shedding of ACE was increased several-fold. The soluble form of ACE shed upon APMA stimulation was cleaved at the same Arg-Ser bond in the...
  • 9
  • 539
  • 0
“SCENOPHOBIA”, GEOGRAPHY AND THE AESTHETIC POLITICS OF LANDSCAPE “SCENOPHOBIA”, GEOGRAPHY AND THE AESTHETIC POLITICS OF LANDSCAPE doc

“SCENOPHOBIA”, GEOGRAPHY AND THE AESTHETIC POLITICS OF LANDSCAPE “SCENOPHOBIA”, GEOGRAPHY AND THE AESTHETIC POLITICS OF LANDSCAPE doc

Ngày tải lên : 30/03/2014, 16:20
... an aesthetic appreciation of landscapes, if not the major ingredient, given the everyday flavour of the landscape concept. As an academic problem, the aesthetics of Na- ture and landscapes ... re-theorization of nature and dissolution of the subject–object dualism has led to a marked retreat of the visual paradigm in landscape geo- graphy. The critiques of the visual emphasis have been of ... the United States for managing federal lands are a case in point (Bureau of Land Management 2003). They involve the delineation and mapping of geo- graphical units that are rated and ranked according to...
  • 15
  • 474
  • 0

Xem thêm