the standard form of a journal entry has the

...

Ngày tải lên: 12/03/2014, 00:21

... DosH as a template and using the following respective 5Â-sense primers: 5Â-gatga gtcgggagACCcagctggagaaaaaag-3Â,5Â-gatgagtcgggagTTTcag ctggagaaaaaag-3Â,5Â-ggacccgttttgcgACCtcgaaagtgagc-3Â, and ... data based on our data and that of others have accuracies of % 3–5 mV. Even taking the accuracy into consideration, redox poten- tials of Ec DosH proteins have an apparent hysteresis in the data, ... decreased the rate of auto-oxidation [5], whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water mole- cules with the proximal ligand His77, markedly increased...

Ngày tải lên: 16/03/2014, 13:20

... spectro- photometrically in the ultrafiltrates on the basis of the absorbance at 223 nm. The number of HNE covalent adducts ⁄ equivalent of OBP was finally calculated by sub- tracting the values determined in the ... of OBP against HNE cytotoxicity in a simplified model simulating the nasal epithelium The aim of this experiment was a preliminary evalua- tion of the protective role of OBP against chemical aggression ... OBP. The purification of the protein was obtained by affinity chroma- tography with a Ni-NTA Agarose (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The aggregation state was...

Ngày tải lên: 23/03/2014, 10:20

... functions, has led to extensive research in the development of small RGD-containing peptides as anti- thrombotic agents. Elucidation of the pharmacophoric nature of the Asp and Arg side-chains allowed ... with the binding of PAC-1 to the activated form of a IIb b 3 . Furthermore, a IIb 313–332 was found to bind to fibrinogen in a solid-phase binding assay. It should be emphasized that all the experiments ... but also for platelet activation. The rationale of this study was based on the assumption that peptide fragments derived from the a IIb subunit could act as inhibitors of platelet aggregation...

Ngày tải lên: 31/03/2014, 07:20

Ngày tải lên: 28/03/2015, 08:50

Ngày tải lên: 18/02/2014, 01:20

... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway. The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained ... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented in panel (A) , after correction for translation ... depleted of 4.5S RNA. After radioactive labeling of the cells, the PhoE forms were immunoprecipitated and analyzed by SDS/PAGE (Fig. 5). Depletion of 4.5S RNA did not result in the accumulation of...

Ngày tải lên: 08/03/2014, 09:20

... 2007. Atención de la salud a través de las distintas épocas NiñezInfancia Neonatal Posnatal Embarazo Adolescencia Preembarazo Posparto Salud materna PARTO 21 Un balance sobre la mortalidad materna ASIA ... la familia. En cambio, una mejor salud materna puede reducir la pobreza (ODM 1), al ahorrar a la familia las desastrosas consecuencias económicas que acarrea su muerte o discapacidad. La asistencia ... desventajosa condición social, política y económica de la mujer en muchas sociedades. Las tasas más altas de mortalidad materna se registran en países de África subsahariana y Asia meridional Tasas...

Ngày tải lên: 28/03/2014, 23:20

... has a cata- lytic rather than just a substrate binding role. Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization of the anion transition ... hypothesis that the keto intermediate has a cis rather than trans geometry is based on the observation that the enzyme cannot hydrate the trans-keto form of HPDA that is spontane- ously formed in aqueous ... k cat and not the K m values in the BphH hydration of HPDA, suggest- ing that cation has a catalytic rather than just a substrate binding role. BphH is able to transform alternative substrates...

Ngày tải lên: 30/03/2014, 15:20

... conrmed the strong UDP-GalNAc:Fuca1,2GalaGalNAc transferase (A transferase) activity of the enzyme product and allowed detection of a small UDP-Gal:Fuca1,2GalaGal transferase (B transferase) activity. ... Amplification of the cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA. Amplification was performed using the Advantage ... activity. The presence of the mRNA and of the A and B antigens was searched in various BDIX rat tissues. There was a general good concordance between the presence of the mRNA and that of the A antigen....

Ngày tải lên: 31/03/2014, 09:20

...

Ngày tải lên: 12/06/2014, 11:34

Ngày tải lên: 20/06/2014, 21:20

Ngày tải lên: 07/08/2014, 03:22

Ngày tải lên: 11/08/2014, 19:21

Ngày tải lên: 12/08/2014, 03:21

... CAG CAC CTC Amplify N1–N5 promoter fragments Perfect target seq. of miR9 sense TCGAGAATCTAGT TCA TAC AGC TAG ATA ACC AAA GA TAGTA TCA TAC AGC TAG ATA ACC AAA GA TAGTA TCA TAC AGC TAG ATA ACC AAA ... TTAT Construction of CMV ⁄ Gluc ⁄ 3xPT_mir9* Perfect target seq. of miR9* anti-sense CTA GAT AAA GCT AGA TAA TTG AAA GT TACTA TAA AGC TAG ATA ACC GAA AGT TACTA TAA ACG TAC ATA ACC GAA AGT ACTAGATTC Construction ... expression of pri-miR9-3 MAP2 forward CCC AAG AAC CAA CAA GAT GAA RT-PCR for neuronal differentiation MAP2 reverse AAT CAA GGC AAG ACA TAG CGA RT-PCR for neuronal differentiation b-actin forward TGA CGG...

Ngày tải lên: 18/02/2014, 17:20

... release and other statistical releases are available on efama’s website (www.efama.org) Trends in the European Investment Fund Industry in the Second Quarter of 2011 ... and Results for the First Half of 2011 This report was prepared by Bernard Delbecque, Director of Economics and Research EFAMA The European Fund and Asset Management Association ... reflects the change in investor confidence from a high level at the beginning of 2010 to lower levels in 2011, when a constant stream of events from the Arab uprisings and the Japanese earthquake,...

Ngày tải lên: 07/03/2014, 16:20

... release and other statistical releases are available on efama’s website (www.efama.org) Trends in the European Investment Fund Industry in the Second Quarter of 2012 ... and Results for the First Half of 2012 This report was prepared by Bernard Delbecque, Director of Economics and Research EFAMA The European Fund and Asset Management Association ... market funds also enjoyed a modest increase in net assets of 0.9 percent. On the other hand, equity funds registered a decrease in net assets during the quarter (4.1%), and net assets of balanced...

Ngày tải lên: 07/03/2014, 16:20

... cycles. ADAM17 PCR primers: 5Â-GAAGAAGTGCCAGGAG GCGATT-3Â,5Â-CGGGCACTCACTGCTATTACCT-3Â and the uorescent probe 5Â-ATGCTACTTGCAAA GGCGTGTCCTACTGC-3Â, ADAM10 primers: 5Â-TCC ACAGCCCATTCAGCAA-3Â,5Â-GCGTCTCAGTGGT CCCATTTG-3Â ... compound 4-aminophenylmercuric acetate (APMA) stimulated the shedding of ACE but not of APP. The APMA-stimulated secretase cleaved ACE at the same Arg-Ser bond in the juxtamembrane stalk as the constitutive secretase but ... shedding of APP upon incubation of the cells with APMA, the shedding of ACE was increased several-fold. The soluble form of ACE shed upon APMA stimulation was cleaved at the same Arg-Ser bond in the...

Ngày tải lên: 30/03/2014, 14:20