the sources of default risk in a cfi

... bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary ... the gelatin block was evaluated After the centre of the gelatin block had been determined, the mean diameter of the permanent cavity was identified To this end, the length of the permanent cavity ... significant differences between the size of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in...

Ngày tải lên: 11/08/2014, 20:21

Ngày tải lên: 15/02/2014, 13:20

... expands, the correct denotational relationship is maintained by expanding the image in the table using the ~-expression, and then finding the corresponding element in the model If the element in the ... to a model has been augmented with a table that contains each ~-expression and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands, ... that was the denotation of the h-expression was not expanded in the same way as the image in this table, a new element corresponding to the expanded image is added to the model This table allows...

Ngày tải lên: 21/02/2014, 20:20

... to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to maintain ... understand their relationship in terms of what they share and not in terms of what separates them, since their separation is in the service of a common set of principles The powers are all involved ... of my examples are drawn are the United Kingdom, Canada, and Australia Together they present a fertile ground for testing my claims because, until quite recently, Canada and Australia had what...

Ngày tải lên: 07/03/2014, 02:20

... to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to maintain ... understand their relationship in terms of what they share and not in terms of what separates them, since their separation is in the service of a common set of principles The powers are all involved ... of my examples are drawn are the United Kingdom, Canada, and Australia Together they present a fertile ground for testing my claims because, until quite recently, Canada and Australia had what...

Ngày tải lên: 07/03/2014, 02:20

... logical relationship, and the feelings may come all at once in an inexplicable ball of raw emotion You may hear complaints of fatigue, exhaustion, lack of energy, pain, or inability to sleep All of ... Thomae, Carol McNamee, Sandra Baughman, Laura Kiser, Janet Feldman, Tio (the alter ego), Sandra Walsh, Thomas D Moore, Penny Allport, Lisa M Wayman, Ina Albert, and Hernando A Mispireta Thanks ... difficult part of running a group that will meet the needs of the members and the facilitators is the initial planning, organization, and setting up of the group This initial stage can easily be bypassed...

Ngày tải lên: 29/03/2014, 04:20

... South Africa, there is an ongoing debate about whether or not the side-effect profile of HAART may adversely affect the HRQoL of HIVpositive individuals More data about the impact of HAART and HAARTrelated ... onto HAART and increasing survival among these patients, there is a growing need to understand the impact of HAART use on the quality of lives of HIVinfected individuals [4-8] There is a sizeable ... antiretroviral (ARV) therapy progressed to AIDS and died of their disease The rollout of highly active antiretroviral therapy (HAART) through national and provincial programmes has dramatically altered...

Ngày tải lên: 20/06/2014, 08:20

... refer to as pictures of weight k A card of weight k is a pair consisting of a picture of weight k and a k-element subset of N that we will call the label set of the card A hand of weight n and size ... between the cardinality of the sets of hands and the cardinality of the decks For example, when dealing with labelled graphs, Dk is the set of all connected k-graphs whose vertices are labelled by ... k A card of weight k is a connected k-graph labelled by any k natural numbers Equivalently, a card can be specified as a picture and a set of natural number labels To construct the card we label...

Ngày tải lên: 07/08/2014, 06:20

... to calculate the most likely of the four rot risk classes as a function, for each fixed basal area, of the age and the dominant height of the stand, obtaining for each value of basal area a graphic ... distribution of the age of the dominant strata and the site index within the forest area can be seen in Figure The classification of the forest area in function of the stand age and the site index is ... number of pairs of samples ua and ua + d which distance from each other is within the distance lag centred at d, and z(ua ) and z(ua +d) are the values that the variable z takes at samplesua and ua...

Ngày tải lên: 07/08/2014, 16:20

... 0, j The number of matchings in a tree In this section, we turn to the number of matchings in a graph This is also known as the Hosoya index, or the Z-index in mathematical chemistry For a rooted ... set as a matching as well Applying the previous technique, we will show the following the electronic journal of combinatorics 17 (2010), #N18 Theorem For m ∈ N, B(m) = Z2 m There are formulae ... the electronic journal of combinatorics 17 (2010), #N18 Consider (T, r) obtained from T1 by joining a new vertex r to r1 Then ϕ(T, r) = (b, b + a) Hence, µ (a, b) ∈ D Inductively adding a leaf...

Ngày tải lên: 08/08/2014, 11:20

... of the challenge for the Treasury and the Fed, meanwhile, was to talk scores of the world's largest banks into not calling in their Korea loans All these initiatives came to a head at the same ... it off was the initial public offering of Netscape, a tiny two-year-old software maker in Silicon Valley that had al- most no revenues and not a penny of profits Netscape was actually giving ... reserves of dollars This sequence of events led to the so-called Asian contagion, a series of financial crises that began with the collapse of the Thai baht and Malaysian ringgit in the summer of 1997...

Ngày tải lên: 09/08/2014, 19:22

... reckless gambling rarely pays off in the end The risk taking I have in mind is the rationally calculated kind of most business judgments It has to be the case that restraint on freedom of action, the ... heavily invested in loans backed by real estate as collateral, as real estate prices soared When the turn came and prices cascaded downward, the collateral became inadequate But instead of calling ... which are already prominent in this book Australia and New Zealand are particularly interesting in how they developed after adopting market-opening reforms and gradually increasing ties with Asia,...

Ngày tải lên: 09/08/2014, 19:22

... global trading partners, and that calls for a broader explanation of the causes of U.S income inequality Part of the explanation is the more elaborate welfare systems, especially in Europe, that ... But by then, they are all too visible The rapid pace of globalization of trade is being more than matched by an expanding degree of globalization of finance An effective global financial system ... stock, the fairly dramatic decline in the average age of the stock, and the creation as a consequence of a high degree of insecurity for those individuals in the labor markets who have to deal with...

Ngày tải lên: 09/08/2014, 19:22

... central planning throughout the world, with China and India in the vanguard The evidence of increasing property rights, and the rule of law more generally leading to increasing levels of material well-being ... decades ago was equal to that of China, but is now less than half of China's and still losing ground It is conceivable that India can undergo as radical a reform as China and become world-prominent ... implicit in one's current undertaking and pay a royalty to the originator of each one Rather than adopting that obviously unworkable approach, Americans have chosen instead to follow the lead of British...

Ngày tải lên: 09/08/2014, 19:22

... patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and interpreted the patient data and were ... discharge, his bradycardia had reversed and his heart rate had increased to 85 beats/minute, which suggests that the initial bradycardia was likely related to the infusion of aminocaproic acid ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated...

Ngày tải lên: 11/08/2014, 03:20

... patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and interpreted the patient data and were ... discharge, his bradycardia had reversed and his heart rate had increased to 85 beats/minute, which suggests that the initial bradycardia was likely related to the infusion of aminocaproic acid ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated...

Ngày tải lên: 11/08/2014, 07:20

... rs4578621 F : CAAGCTGGGTGCACTGGC 185 R : GAGAAATAGAGGAATTAACC rs6496589 F : CTGCCAACACTCG AGCTG 110 R : ACCTGACTCTTCCTTGTCT rs894160 F1 : GCTGAGACTGAGTCACATGC 403 R1 : GCTGAGACTGAGTCACATGC F2 : CTGTTTGTGGGGCTCCCTCG ... et al reported that the A allele was associated with enhanced basal and noradrenaline-induced lipolysis in human subcutaneous fat cells [7], it does not seem to have a major impact in human French ... Paris, France (available at http://gene canvas.ecgene.net/downloads.php) Statistical significance was defined at the 5% level Power calculation was done with the Epi Info 6.04 software available...

Ngày tải lên: 11/08/2014, 08:20

... hypoxia and lactic acidosis can maintain all the described pathophysiologic mechanisms and induce a relative deficiency in vasopressin plasma concentration further amplifying the vasoplegic scenario ... available experiences [12], the above described pharmacological rationale and the choice of avoiding escalating therapy with alpha agonists This pharmacological approach allowed us to titrate the ... effects of administered catecholamines [6] Epinephrine has been widely accepted to be the standard medical therapy to reverse cardiovascular collapse in anaphylaxis Because of its α and β adrenergic...

Ngày tải lên: 11/08/2014, 11:20

... of disease in the total population The pattern remained the same when we repeated the analyses for a disease risk of 10% (Additional file 3) Increasing the OR of all variants included in the genetic ... risk because all variants have the same frequency of the risk genotype and the same OR The disease risk increases with the number of risk genotypes in the genetic risk model In the AMD simulation, ... have a frequency of 5% (a) , 30% (b) and 50% (c) Five to 600 variants are included in the genetic risk models to obtain an increase in the AUC Each risk variant has a frequency of 30% and OR of...

Ngày tải lên: 11/08/2014, 12:21

... Talecris and participated in the design of the study, in the collection, analysis and interpretation of data (CD was the statistician for the study), in the writing of the manuscript and in the ... EXACTLE trial was designed to explore the use of CT densitometry as an outcome measure for the assessment of plasma AAT augmentation therapy in individuals with AATD The analytical approach, and ... indicate a graded response to therapeutic augmentation of AAT The graded therapeutic effect that was most evident in the basal region may indicate that the progression of panlobular emphysema might...

Ngày tải lên: 12/08/2014, 14:20