... Pain Polarizing discussions during the past 10 years have made the role of the dentist in diagnosing and treating pain in the head and neck region increasingly obscure rather than more clear In ... neuralgia Herpes zoster Peripheral neuritis Neurovascular pain Vascular pain Episodic pain Paroxysmal neuralgia Glandular, ocular, and auricular pain Pulpaf pain Viscera! pain Visceral mucosal pain ... Cluster headache Paroxysmal unilateral headache Neurovascular variants Arteritis pain Carotidynia joint surface pain Retrodiscal palm Capsule pain Ligament pain Arthritic pmn Myofascial pain Myositis...
Ngày tải lên: 06/03/2014, 11:20
... strengthen the technical learning ability of the economy in a period of radical technical change They concluded that the capability of national economies to learn abou, adapt and change their instiutional ... innovation are increasingly being framed within an international arena The links between sub-regional, regional, national and international systems of innovations imply hat analyses should include ... the Faculty of Arts and the Faculty of Medicine in 1935, the Faculty of Economics and Law in 1936, the Faculty of Theology in 1942 and, finally, the Faculty of Science in 1954 The main reason...
Ngày tải lên: 16/01/2014, 16:33
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
... study of 3260 enrollees in a national managed care organization in the United States, that 23% of the English-speaking and 34% of the Spanish-speaking respondents could not adequately read and ... than words alone However, words are still important in explaining the implications of the pictures and in explaining what is happening in the pictures This hypothesis includes the same qualification ... Koplan JP Health literacy among medicare enrollees in a managed care organization JAMA 1999; 281:545–51 [10] International Reading Association, Special Interest group on reading and readability...
Ngày tải lên: 14/03/2014, 21:20
báo cáo hóa học:"The role of disclosure in relation to assent to participate in HIV-related research among HIV-infected youth: a formative study" docx
... Ethical approvals The formative research was approved by the Institutional Review Boards at the Kinshasa School of Public Health in the DRC and at the University of North Carolina at Chapel Hill in ... should be a component of the research, being mindful that the minors participating in the research may in fact want to know that they have HIV Participation in the research could serve as a first ... be told at the beginning of the research Their reasons focused on reducing the children being taken aback upon learning their status during the course of the research and for enhancing the children's...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGAATCCCCGCAGACCATGACAC fwd ACGTTGGATGAGTCGGTAGCAACACCAGG ... ACGTTGGATGTTGCTCAGCCCCAAAGATGG fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCC rev ACGTTGGATGTATGGTTCGACTGAGTCCAC ACTCGAGGCCTGTGAATTCC 93.73 GCCGGCTCCCAAGCTCC 92.03 CCTGCTGGCCATGCTCCTCAGC 92.99 GCTGCCTCTGCTCCCAGG...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot
... preparation and toxin quantification RV participated in animal experimentation AA was involved in histopathological studies and image analysis FV participated in coordination of experiments and manuscript ... TUNELand caspase-9-staining were located in alveolar macrophages at 12 h post-infection (Figure 2A) Leukocytes situated in areas of cellular infiltration, and bronchial epithelia appeared progressively ... BAL are related to the bacterial burden The significant decrease in number of bacteria after 12 h of infection is probably due to the host response, and was also observed in another intranasal...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx
... by inhalation of Gramnegative bacteria, simultaneous intravenous administration of recombinant human antithrombin caused histologic damage, injury to the alveolar capillary barrier and increased ... that if administration of heparin concomitantly with antithrombin is withheld, then the antiinflammatory potential of the latter can be improved Disseminated intravascular coagulation and antithrombin-dependent ... Both of these inhibit serine proteases and cofactors/activated coagulation factors [1] Antithrombin is a 58 kDa glycoprotein that is composed of a single amino acid chain with a plasma concentration...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: " The role of recombination in the emergence of a complex and dynamic HIV epidemic" pptx
... from India, but not Africa as India has (Additional file 1, Fig S2B) Finally, the dominant South American C epidemic appears to have derived from a single introduction from Africa ([45,46] and Additional ... cover a full HIV-1 genome of each subtype, meaning that there was a potential to form any BF recombinants in Argentina and that there was no need to assume that already-recombined genomes came ... recombinants in South America is not clear, but it appears that at least one of the main introductory routes of HIV-1 into South America was through Brazil [41] Accurate virus genotyping and recombination...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "Correction: The role of corticosteroids in severe community-acquired pneumonia: a systematic review" docx
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: " Updating the evidence for the role of corticosteroids in severe sepsis and septic shock: a Bayesian meta-analytic perspective" pot
... the variability in intra-trial reporting, this was not feasible As the hazard ratio may be approximated from the OR [23], we chose the OR as an appropriate metric [24] Bayesian parameter estimates, ... Central Register of Controlled trials, Cochrane database of systematic reviews, American College of Physicians Journal Club, Health Technology Assessment Database and Database of Abstracts of Reviews ... colleagues Annane and Table Trial patient data by outcome (Continued) #, mortality statistics for Chawla and colleagues [47] were abstracted from the Annane and colleagues meta-analysis[6] ##, data...
Ngày tải lên: 13/08/2014, 21:21
A transmembrane mutation in FcgRIIb reveals the role of ceramide in phagocytosis and autoimmunity
... moiety can vary in terms of chain length of the fatty acids and in the degree of saturation and hydroxylation of the sphingoid base Also, variations in the type, number and linkage of sugar residues ... particle The receptor-ligand interaction activates signal transduction pathways that result in the internalization of the target particle The internalized particle is contained in a plasma membrane ... due to the various combinations of polar headgroups, fatty acyl chains and aliphatic hydrocarbon chains structures The headgroup of the lipids can vary, as can the fatty acids, which differ in length...
Ngày tải lên: 10/09/2015, 09:01
A study of the role of guanxi in sino japanese distribution channel relationships in china
... of the Sino-Japanese relation in regards to politics, the economy, and cultural communication 2.4.1 Japan in China’s Media To examine the propaganda about Japan in China’s media, an investigation ... China and Japan has developed actively since the 1980s In particular, Japan’s investment has increased dramatically Entering the Chinese market has become a popular issue among Japanese businessmen ... in china serving as a social key towards achieving various goals There is a large body of literature evaluating the nature and role of guanxi in Chinese society The importance of guanxi relationship...
Ngày tải lên: 26/09/2015, 10:13
The role of serum amyloid a in atherosclerosis
... minimization of tissue damage and promotion of healing (Baranova et al., 2010; Sandri et al., 2008) In the event of a tissue injury, the acute phase response initiates the activation of a cascade, ... Receptor Interacting Protein (RIP1) instead of with Fas associated death domain (FADD) and caspase would activate the NFκB survival mechanism (Oeckinghaus et al., 2011) As the absence of TRAF2 would ... SAA-LDL complex have also been reported (Kotani et al., 2009; Ogasawara et al., 2004) At elevated level, SAA is able to replace apoA-I in HDL, taking over as the predominant apolipoprotein of...
Ngày tải lên: 12/10/2015, 17:36
Circuit theory of finance and the role of incentives in financial sector reform
... further assess the riskiness of the bank Finally, the inadequacy of the static accounting framework, underpinning the capital ratios approach, in tracing the dynamics of the bank’ trading strategy; ... is offered in India by the non-banking financial companies sector (Pahwa, 1998) Another important advantage of any informal-formal link is that formal financial institutions would have an incentive ... that the availability of aggregate saving per se can never be an issue, as investment always generates an equal amount of saving, whatever the saving behavior of agents However, the model points...
Ngày tải lên: 24/10/2012, 09:33
Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient
... colorectal carcinoma [33] There was also a focal expression of MUC6 in the colonic epithelium in the teratoma (Table 1), a finding we have also made in a study on colorectal carcinoma [34] The tissue ... feature of various cancers including cancer of the colon [33] The amino acid analysis of the purified mucin gave high amounts of ‘mucin-like amino acids, serine, threonine and proline Serine and ... acid analysis of purified mucin from a mature ovarian cyst teratoma Amino acid Aspartic acid (D) Threonine (T) Serine (S) Glutamic acid (E) Proline (P) Glycine (G) Alanine (A) Cysteine (C) Valine...
Ngày tải lên: 26/10/2012, 10:03
The role of language in adult education and poverty reduction in Botswan
... the other languages that exist in the country, the adult language program in Botswana maintains the hegemony and the gap between the poor and the rich, the major and minority groups In order to ... practice in Botswana is that illiterates in the adult education program are taught in Setswana even in environments where it is not the native language Setswana is not the native language for at least ... as long as it aims to make people literate in Setswana only and there is very little material in other languages Literacy can be established and maintained if only there is a wider coverage of...
Ngày tải lên: 05/11/2012, 16:27
The role of advertising in society
... need of more In the absence of the massive and artful persuasion that accompanies the management of demand, increasing abundance might well have reduced the interest of people in acquiring more ... vital tools in Marketing The appearance and the role of advertising is increasingly higher in the market economy Advertising shows the rapid growth in technology and lifestyle, in people’s tastes ... national advertisers in newspapers, and cigarettes constitute the second largest category of magazine advertising (behind transportation) This has led to charges that magazines and newspapers avoid...
Ngày tải lên: 16/04/2013, 11:05
Tài liệu Determining the Length of Columns in a SQL Server Table doc
... // Add table mappings da.TableMappings.Add("Table", "Orders"); da.TableMappings.Add("Table1", "Order Details"); // Create the DataSet DataSet ds = new DataSet( ); // Fill the schema and data da.FillSchema(ds, ... Microsoft SQL Server Books Online The GetSchemaTable( ) method of the DataReader also returns all column lengths The method returns a DataTable containing column metadata for a DataReader, where the ... name The code then iterates over the collection of columns in the table and displays the length, precision, and scale for each from the Hashtable Information from the FillSchema( ) method of the...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Improving health, connecting people: the role of ICTs in the health sector of developing countries ppt
... an approach is beginning to transform life in rural Indian villages Example 12: Wireless internet access in rural India In Tamil Nadu state in India, the Sustainable Access in Rural India (SARI) ... potential tool - in Ghana a number of agencies, including the Health Foundation of Ghana, have now had their staff trained and are beginning to develop local language videos that can be shared ... particular area This yes/no information can be entered into a mobile phone and sent to a central database By creating an up to date database of health information, health workers can track infectious...
Ngày tải lên: 14/02/2014, 09:20
Tài liệu The Role of Nutrition in Maintaining Health in the Nation’s Elderly: Evaluating Coverage of Nutrition Services for the Medicare Population ppt
... of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... Administration (HCFA), as mandated in the Balanced Budget Act of 1997 The committee was charged with the task of analyzing available information, holding a workshop, and making recommendations regarding technical ... Cardiology-American Heart Association and by the Agency for Healthcare Research and Quality Diabetes Available evidence from randomized clinical trials, including data in substantial numbers of individuals...
Ngày tải lên: 15/02/2014, 16:20