the role of a security manager within different organizations

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC 2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of Minnesota College of ... structure-based analysis of staphylococcal nuclease. Proteins: Structure, Function and Genetics 27, 171–183. 15 Flanagan JM, Kataoka M, Fujisawa T & Engelman DM (1993) Mutations can cause large changes ... reported that multiple mutations can cause large changes in the average conformation of denatured proteins. Here we show that a specific single mutation or removal of a specific fragment can cause large...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... higher value almost 2.5-fold higher than the native cold adapted enzyme (Table 1). The mutant G26 1A/ Y26 9A exhibits an E a almost the same as in the case ofthenativeenzyme(Table1). Thermal inactivation ... gene encoding alkaline phosphatase from the Antarctic strain TAB5 [16]. Based on the crystal structure (at 2.4 A ˚ )ofanEscherichia coli alkaline phospha- tase variant with a 28% amino-acid sequence ... from the Antarctic Table 1. Enzymatic and thermodynamic parameters of the psychrophilic alkaline phosphatase and mutants. Reported values were determined at 10 °C. The k cat values were calculated...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf

Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf

... of the transistor indicated a spiral model of interac- 50 Since 1970, the State has funded both capital investments and the running of the University of Aarhus in the same way as for the other ... regions make it impossible to take advantage of the full growth potential of a univer- sity. Another hypothesis is that the size of the regional impact of a university pri- marily reflects the characteristics ... Ålborg and Roskilde, together with the expansion of the number of students at the Aarhus School of Busi- ness in the 70s and the 80s, the rate of growth decreased and the number of students was maintained...

Ngày tải lên: 16/01/2014, 16:33

180 597 1
Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx

Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx

... control The way the knowledge transfer programme was managed also differed between plants. The idea of the central programme management was that, at the least, plants should make yearly plans for each ... (production manager) . Aspiration and strategic ambitions Because each plant investigated was run as a profit centre and was normally measured (by corporate headquarters) on operating margin and/or ... have. The role of motivation is probably as important in a chain of hotels or super- markets, a software vendor or a consulting com- pany, regardless of the nature of knowledge. The method of analysis...

Ngày tải lên: 24/01/2014, 00:20

12 515 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

... REPRESENTATIVES John B. Bass, Jr., M.D. American Thoracic Society University of South Alabama Mobile, AL Nancy E. Dunlap, M.D. American College of Chest Physicians University of Alabama at Birmingham Birmingham, ... heterogeneity in the efficacy of the BCG vaccine reported in the individual studies. Using a model that included the geographic latitude of the study site and the data validity score as covariates, they ... Public Health Veterinarians Keith A. Clark, D.V.M., Ph.D. Texas Department of Health Austin, TX National Vaccine Program Anthony Robbins, M.D. Office of the Assistant Secretary for Health Washington,...

Ngày tải lên: 15/02/2014, 13:20

27 1,3K 3
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawaharlal ... in enzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv Protein Chem 66, 315–372. 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disallowed Ramachandran...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx

Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx

... using IMAGEQUANT software, and depurination was calculated by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressing values as a percentage. Reassociation and quantification of ... quantitative activity assays of these RTA variants, was not achieved. To assess whether substitution at Asn78 with Ser changed the catalytic activity of RTA, the N-glycosidase activity of RTA N78S against ... collection and refinement statistics are given in Table 1. Assay of the N -glycosidase activity of ricin A chain variants The activity of each of the RTA variants was determined by assessing their ability...

Ngày tải lên: 19/02/2014, 12:20

10 617 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... epitope tag was added t o the end of t he ESSS ORF. The forward primer was: 5Â-ACga atccGATCTCCGACCCA-3Â; the reverse primer was: 5Â-ATgctagcCTCATCTTCTGGTAACTGG-3Â. Small bo ld letters refer to the ... antibodies were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively. Antibodies ... analyses of the ESSS cDNA in these mutants revealed chain termination mutations. In two of these mutants the protein i s truncated at the C-terminus of the targeting sequence; the m utants are...

Ngày tải lên: 19/02/2014, 16:20

9 623 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

... enterprises, as well as the actual constraints exerted by the structure of a balance sheet are still limited, a qualitative survey may actually offer a stronger appraisal of their actual behaviors. Section ... determinants of the probability of making profit, but this would be a set of given, ‘frozen’ parameters, rather than adjustment variables on which the managers’ strategies would actually be able bear. ... would have to take into account the evolution of real wages as well as of wage arrears. However, a remarkable point is that a substantial proportion of firms (31.5% of the sub-sample) has increased...

Ngày tải lên: 06/03/2014, 08:20

30 635 0
TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx

TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx

... (Nickel and McLachlan 1994). 38 Function and structural adaptation of the condyle Summary of the basic anatomical and functional changes in the condylar portion of the joint. Increased functional ... subchondral cartilage has not yet been affected and would appear in- tact on a radiograph. 35 Buildup of the condylar cartilage Histologically, the secondary cartilage of the condyle is made up of ... Neurovascular pain Vascular pain Glandular, ocular, and auricular pain Pulpaf pain Visceral mucosal pain Periodontal pain Connective- tissue pain Ostealgia m6 periosteal pain ...

Ngày tải lên: 06/03/2014, 11:20

379 1,2K 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

... glycosyl- transferase elucidate catalysis in the alpha-amylase family. Nat. Struct. Biol. 6, 432–436. 16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai, A. , Henrissat, B. & Dijkstra, ... However, the mechanistic roles of several of these residues are not described well and there is no example of mutational analysis of all of these residues in the same enzyme. To obtain an insight ... regard to the role of Asp140, whichappearstobecrucialinChiBandinchitinaseA1 from Bacillus circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases...

Ngày tải lên: 07/03/2014, 14:20

10 652 0
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx

MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx

... in the analysis of game-theoretic models (chapter 10) –how one player responds to the actions of another on the assumption of a speci…c form of the rules of the game. We use the comparative statics ... equation: q = F(K; L) (“quantity of output = a function of capital and labour”), which is a convenient way of picking up some of the features that are essential to analysing the behaviour of the ... because the method of proof is not particularly illuminating or is rather technical.  Throughout each chapter there are footnotes that focus on detailed points of the argument. These take the...

Ngày tải lên: 08/03/2014, 10:20

668 5,1K 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc

The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc

... imbalance, educational imbalance, and where they are fearful of appearing stupid and fearful of rejection or abandonme nt. As a result, they are hesitant to admit that they do not understand ... literacy among medicare enrollees in a managed care organization. JAMA 1999; 281:545–51. [10] International Reading Association, Special Interest group on reading and readability. Newark, Delaware, ... novel about asbestos hazards or an NCI asbestos pamphlet were mailed, with an evaluation questionnaire, to a random sample of 500 members of a building trades union. There was a 21% response rate...

Ngày tải lên: 14/03/2014, 21:20

18 919 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA ... Mutation Direction Sequence Standard All Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G ... CCTCATTTCCTCCGGGAAGACTTTTGAATA C N77G Forward CGGACAAGGTGAGGACTTGGTACTTACTGGATAC Reverse CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem....

Ngày tải lên: 17/03/2014, 10:20

10 533 0
w