... human rights law Ronagh McQuigg The EU as a ‘Global Player’ in Human Rights? Jan Wetzel Human Rights in the Asia-Pacific Region Towards Institution Building Hitoshi Nasu and Ben Saul Vindicating ... include: The Human Right to Water and its Application in the Occupied Palestinian Territories Amanda Cahill Emerging Areas of Human Rights in the 21st Century The role of the Universal Declaration ... of Human Rights Marco Odello and So a Cavandoli The European Court of Human Rights in the Post-Cold War Era Universality in Transition James A Sweeney Children and International Human Rights Law...
Ngày tải lên: 13/10/2016, 11:38
... above are international in the sense of being global in coverage There are also several international human rights agreements that are regional in coverage, in Europe, in the Americas, and in Africa ... Several other international bodies also play roles in relation to human rights as part of their broader mandates These include regional bodies dedicated to carrying out the regional human rights agreements ... describes the international human rights system in broad terms Chapter describes the role of food in human rights law, and also in international humanitarian law Part II begins with chapter 4, which argues...
Ngày tải lên: 14/03/2014, 21:20
Báo cáo y học: "The shunt from the cyclooxygenase to lipoxygenase pathway in human osteoarthritic subchondral osteoblasts is linked with a variable expression of the 5-lipoxygenase-activating protein" doc
... crucial for therapeutic intervention in OA The actual therapies for OA are somewhat limited to a decrease in pain in affected joints with the use of either non- Available online http://arthritis-research.com/content/8/6/R181 ... factor beta upregulates 5-lipoxygenase activity during myeloid cell maturation Proc Natl Acad Sci USA 1993, 90:5984-5988 47 Futani H, Okayama A, Matsui K, Kashiwamura S, Sasaki T, Hada T, Nakanishi ... The decrease in prostaglandin and thromboxane levels is probably the basis for the anti-inflammatory and analgesic activity of the NSAIDs that are widely used for the treatment of OA Newer drugs...
Ngày tải lên: 09/08/2014, 08:23
Tài liệu Importing the Law in Post-Communist Transitions The Hungarian Constitutional Court and the Right to Human Dignity pptx
... Human Rights Law in Perspective General Editor: Colin Harvey The language of human rights figures prominently in legal and political debates at the national, regional and international levels ... In the UK the Human Rights Act 1998 has generated considerable interest in the law of human rights It will continue to provoke much debate in the legal community and the search for original insights ... throughout the region in the transition towards liberal democracy.22 the state The state is answerable to the individual for its activity To affirm and ensure human rights and freedoms is the main duty...
Ngày tải lên: 18/02/2014, 11:20
Cambridge.University.Press.Who.Believes.in.Human.Rights.Reflections.on.the.European.Convention.Oct.2006.pdf
... 80–101, at 92 Leaving aside that human rights as a religion cannot be rationally validated (i.e proved right) , it appears to me that human rights can be and indeed are rationally invalidated (i.e proved ... faith According to a standard definition, human rights are those rights one has by virtue of being human. 1 This definition suggests that human rights belong to every human being in every human ... concept of human rights? Are they such as to make it, even on its own historical terrain, invalid? Practical and conceptual critiques of human rights Scepticism regarding human rights has a long...
Ngày tải lên: 21/09/2012, 11:02
Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc
... training or career development grants from the organizations These beginning investigators described the challenges they faced in having to fulfill their research, teaching, administrative, and ... directed to laboratory-based academic scientists, much of the material would also be of use to beginning investigators in government and industry labs The first chapter, “Obtaining and Negotiating a ... chapters deal with people skills “Laboratory Leadership in Science” summarizes the role of the head of the laboratory in leading, motivating, and managing members of a lab “Mentoring and Being Mentored”...
Ngày tải lên: 21/02/2014, 12:20
Báo cáo khoa học: Linking environmental carcinogen exposure to TP53 mutations in human tumours using the human TP53 knock-in (Hupki) mouse model doc
... E Kucab et al Investigating human cancer aetiology using the HUF immortalization assay Thus far, four environmental carcinogens have been examined using the HUF immortalization assay: (a) UV ... mutagens and potential human carcinogens identified in diesel exhaust and ambient air pollution [69–71] Indeed, 3-NBA induces squamous cell carcinoma in rat lung after intratracheal administration ... areas of Serbia, Bosnia, Croatia, Bulgaria and Romania BEN is clinically and morphologically very similar to AAN; indeed, AA-specific DNA adducts have been detected in BEN patients and in individuals...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA ... Ala forward Phe700 fi Ala reverse Phe718 fi Ala forward Phe718 fi Ala reverse Val736 fi Ala forward Val736 fi Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC ... TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC TGTCGGCACCTCCAGGCTATCCCTGTGGCACCA TGGTGCCACAGGGATAGCCTGGAGGTGCCGACA...
Ngày tải lên: 16/03/2014, 12:20
The Right to Property in Commonwealth Constitutions potx
... public and private international law In many ®elds (such as the protection of human rights and democratic standards, investment guarantees, international criminal law) international and national ... tool in the making of law at national, regional and international levels Private international law is increasingly affected by international conventions, and the issues faced by classical con¯icts ... early draft of chapter 4, my brother, John Allen, for reading an early draft of chapter 5, and Michael Taggart for reading a draft of chapter Their advice was invaluable Any errors that remain...
Ngày tải lên: 23/03/2014, 05:23
one more zero. how to trade the forex like a pro in one hour
... Condition todays close < todays open todays close > todays open todays close = todays open Calculation todays high + todays low + todays close + todays low = X todays high + todays low + todays close ... que le marchộ a cessộ de monter.Une approche plus dộfinitive dộclare cela la rộsistance est la semaine avant haute et l'appui est la semaine avant basse.Si tu emploies les signaux marchands pour ... dans cette table Australian Dollar $FXAU Brazilian Real $FXBR Canadian Dollar $FXCA Chinese Yuan $FXCN Denmark Krone $FXDK EMU Members Euro $FXEU Hong Kong Dollar $FXHK Indian Rupee $FXIN Japanese...
Ngày tải lên: 23/04/2014, 15:51
báo cáo sinh học:" Human resource leadership: the key to improved results in health" pptx
... participants often replicate the principles in many areas of their work and teach them to others The LDP makes a profound difference in health managers' attitudes toward their work Rather than feeling ... of thinking about leading and managing to sustain these positive results and scale them up Health managers at a recent HR leadership meeting in Southern Africa described their problems as follows: ... of the LDP has been adapted, for example, to accommodate people from rural areas The program has been translated into French, Spanish, Portuguese, and Arabic One important finding is that participants...
Ngày tải lên: 18/06/2014, 17:20
a return to love reflections on the principles of a course in miracles
... completely The mess got so thick that all the king’s horses and all the king’s men couldn’t make Marianne function again The hysterical woman inside me was in a maniacal rage, and the innocent child was ... Fear is an illusion Our craziness, paranoia, anxiety and trauma are literally all imagined That is not to say they don’t exist for us as human beings They But our fear is not our ultimate reality, ... though the mind has been split in two; one part stays in touch with love, and the other part veers into fear Fear manufactures a kind of parallel universe where the unreal seems real, and the real...
Ngày tải lên: 04/07/2014, 15:17
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... minimum (IP) mechanical load areas were obtained from each femoral head The horizontal bar indicates the median, the box is the interquartile range, and the vertical lines indicate the atypical ... Figure Analysis of aggrecan and type II collagen in OF and OA cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and ... results are relative to a certain sample pertaining to the experiment Separated maximum (SP) and minimum (IP) mechanical load areas were obtained from each femoral head The horizontal bar shows the...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps
... and their expressions as ratios of a covariance to a variance indicate that they can also be obtained from a linear approximation This comment makes it possible to extend easily the approximate ... J.L., San Cristobal M., Gianola D., Im S., Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal 13 ... or infinitesimal model, in which each individual has a genetic value governing a multiplicative factor for the environmental variance Since the analysis needs the evaluation of phenotypic variances...
Ngày tải lên: 09/08/2014, 18:21
báo cáo khoa học: "The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report" ppt
... and made the final review All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: 18 April 2011 Accepted: 18 August ... publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Author details Department of Anatomy, Medical ... The compartments of the hand: an anatomic study J Hand Surg Am 1998, 23:682-686 Jacobson MD, Raab R, Fazeli BM, Abrams RA, Botte MJ, Lieber RL: Architectural design of the human intrinsic hand muscles...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx
... response in the asthmatic might be that myosin bridges never see strains that large This is perhaps because the majority of the mechanical strain in the asthmatic airway during a DI is taken up by increased ... cytoskeleton are surely important factors, but how they interact and details about underlying mechanisms remain unclear Muscle shortening velocity also seems to be an important factor [4,25,26] In addition, ... endogenous dilating substance such as nitric oxide [11] Taken together, the weight of available evidence seems to support the idea that loss of the dilating response to a DI may indeed play a central role...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: " Gunshot bullet embolus with pellet migration from the left brachiocephalic vein to the right ventricle: a case report Nicholas Greaves" pptx
... complications of retained intravascular emboli include claudication, parasthesiae, pain, pleural effusion, pericardial effusion, pulmonary abscess, pulmonary infarction, gangrene, endocarditis, arrhythmias, ... vetriculoseptal defect thereby excluding a paradoxical embolus The patient remained asymptomatic throughout the admission and was discharged after days Out-patient review with x-rays at weeks and months after ... (pellet) artefact in the right atrium Note also the pellets in the left arm ventricular and valvular function with the pellet still in the right ventricle It showed there was no patent foramen ovale...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... photographed NAD+ measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... AGCTTACTCATATCGATTTCATACGACTT 1172 BUD6F CAGACCGAACTCGGTGATTT 1173 BUD6R TTTTAGCGGGCTGAGACCTA 1163 HSP12F AAGGTCGCTGGTAAGGTTCA 1164 HSP12R GCTTGGTCTGCCAAAGATTC 1244 PNC1F TTGTGGTCACCAGAGATTGG...
Ngày tải lên: 14/08/2014, 21:20
Design of LCL filters for the back to back converter in a doubly fed induction generator
... (10) Transfer function in (8) has a pair of poles located at the imaginary axis The imaginary poles will cause oscillation to the system, which requires the filter to be damped to avoid resonance ... rated at 2.5MW with a 690V voltage (line to line, 50Hz) The stator rotor turns ratio is 0.3, and other parameters are listed in the Appendix The converter dc-link capacitor is 20,000uF, the dc-link ... Damping resistors are widely used to increase the stability of the system due to its simplicity and reliability Studies have shown that the greater the damping resistor, the better resonant inhibition...
Ngày tải lên: 25/08/2016, 19:15