the rational design of t cell epitopes with enhanced immunogenicity
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
Ngày tải lên :
07/03/2014, 16:20
... primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively ... interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site...
- 9
- 485
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
Ngày tải lên :
19/02/2014, 13:20
... primary structure of the peptide To confirm our hypothesis that the b-turn structures are important for the inhibitory activities of the peptides, the structures of the cyclic peptides were determined ... inhibitory activity of the cEL peptide and the very low inhibitory activity of the cYT peptide compared to other peptides The flanking residue of the b-turn, i.e Tyr3 of the cVY peptide appears to ... different concentrations studied These peptides were also tested for their toxicity using the MTT assay [17] All the four peptides tested in the study resulted in 90–100% viability indicating that these...
- 14
- 657
- 0
Báo cáo khoa học: Template-assisted rational design of peptide inhibitors of furin using the lysine fragment of the mung bean trypsin inhibitor pptx
Ngày tải lên :
16/03/2014, 13:20
... inhibitors H Tao et al Fig Stability of the mutants during incubation with furin (A) and kexin (B) The inhibitory activities of the mutants were determined at different time intervals Fig Identification ... generated during the reaction for 80 at °C After removal of the HF, the product was washed with ethyl acetate and extracted with 0.1% trifluoroacetic acid containing 20% acetonitrile The extract was lyophilized ... for the interaction with the enzyme Conclusions We have demonstrated through a series of incremental modifications to the Lys fragment of MBTI that a potent furin inhibitor can be designed Further...
- 8
- 332
- 0
báo cáo hóa học:" Intrinsic and extrinsic factors influencing the clinical course of B-cell chronic lymphocytic leukemia: prognostic markers with pathogenetic relevance" docx
Ngày tải lên :
18/06/2014, 15:20
... TP53, the TP53 activity is primarily inhibited through direct and tonic interaction with the MDM2 protein [32] Treatment of various tumor cells with inhibitors of the MDM2-TP53 interaction results ... only to the cases expressing the same IGHV genes but without the same stereotyped BCR [89,92] Among the few M clusters that are shared by the majority/ totality of the datasets, there are two ... therapeutic strategy for treatment of CLL patients [37] In CLL, TP53 is mutated in about 10% of patients at presentation and in 10% to 30% of patients with pretreated disease [38-40] TP53 can...
- 14
- 640
- 0
Báo cáo hóa học: " Differential sensitivity of melanoma cell lines with BRAFV600E mutation to the specific Raf inhibitor PLX4032" potx
Ngày tải lên :
18/06/2014, 16:20
... demonstrating that out of the 10 cell lines with BRAFV600E mutation, four have amplification of the BRAF locus (Table 1) There was no clear relationship between these amplification events and the ... at this pathway The genomic analysis revealed that alterations in PI3K/Akt, including deletions of PTEN, amplifications of AKT and activating mutations in AKT were distributed throughout the cell ... M233 cells (Figure 2D and 2E) Similar results were obtained with M238 and M263 (data not shown) Taken together with the data on cell cycle inhibition, these data suggest that PLX4032 has cytostatic...
- 11
- 448
- 0
Báo cáo hóa học: " Rational design of HIV vaccine and microbicides: report of the EUROPRISE annual conference" pptx
Ngày tải lên :
18/06/2014, 16:20
... in the majority of patients treated with GH compared to the other groups Despite the high toxicity related to GH treatment reported in the literature, minor adverse events were observed in this ... host It seems likely that the virus present in the patient at the time of sampling and thereafter represents a neutralisation escape mutant HIV-specific cytotoxic cells and other factors than ... vitro testing of the gels and their freeze-dried variants demonstrated an advantage of the freeze-dried tablets The latter displayed better stability, in addition to the Wahren et al Journal of...
- 11
- 681
- 0
Báo cáo sinh học: "Rational design of HIV vaccines and microbicides: report of the EUROPRISE network annual conference 2010" potx
Ngày tải lên :
18/06/2014, 19:20
... replicative capacity of the virus was linked to the level of protection This led to the question - is protection from superinfection due to the presence of the virus in target cells or the replication ... patients It might be possible that some of these antibodies are targeting unknown epitopes, on the other hand, multiple antibodies present at the same time could account for the breadth and potency ... that it is possible to modulate the immune responses in the human host Noteworthy was the observation of Annette Sköld, a EUROPRISE PhD student, showing that the combination of two different TLR...
- 12
- 524
- 0
báo cáo hóa học:" Rational design of HIV vaccines and microbicides: report of the EUROPRISE network annual conference 2010" pptx
Ngày tải lên :
20/06/2014, 03:20
... replicative capacity of the virus was linked to the level of protection This led to the question - is protection from superinfection due to the presence of the virus in target cells or the replication ... patients It might be possible that some of these antibodies are targeting unknown epitopes, on the other hand, multiple antibodies present at the same time could account for the breadth and potency ... that it is possible to modulate the immune responses in the human host Noteworthy was the observation of Annette Sköld, a EUROPRISE PhD student, showing that the combination of two different TLR...
- 12
- 401
- 0
Báo cáo y học: "The role of T cell interleukin-17 in conducting destructive arthritis: lessons from animal models" pps
Ngày tải lên :
09/08/2014, 06:22
... whether or not a patient will respond to anti-TNF and anti-IL-1 therapy AntiIL-17 cytokine therapy might be an interesting new antirheumatic approach that could contribute to the prevention of ... considered an important target for the treatment of destructive arthritis The discovery of IL-17 family members may further extend the role of this cytokine family in arthritis pathology IL-17F showed ... mechanism of action of the novel IL-17 family member(s), with emphasis on the interaction with other known key cytokines in the pathogenesis of arthritis Furthermore, IL23 seems to be an important physiological...
- 9
- 294
- 0
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
Ngày tải lên :
09/08/2014, 10:23
... consent was obtained from all of the patients, and the study was approved by the local bioethical committee of the Institute of Hematology and Transfusion Medicine in Warsaw Complete blood count with ... recurrent infections as well as RA were controlled In all of the patients, arthritis responded well to the treatment Two patients with FS and polyclonal T- LGL lymphocytosis were treated with a combination ... was found Abundant interstitial infiltrates of T cells were observed in the bone marrow, but without intrasinusoidal localization This case seems to support the hypothesis that T- LGL leukemia may...
- 12
- 565
- 0
báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot
Ngày tải lên :
10/08/2014, 22:21
... interesting to detect the evolution of T- cell clonality in the patient at different disease status The features of restrictive usage and absence of partial T cell clones could be found in patients ... the present study, we characterized the T- cell repertoires between the stages of CML-CP and Ph- negative ALL Our previous studies showed that the clonally expanded T cells were associated with ... detected post chemotherapy The distinct distribution of clonal T cells were also detected in different disease stage, the pattern changes in the clonally expanded T cells between the chronic phase...
- 7
- 322
- 0
báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps
Ngày tải lên :
11/08/2014, 12:21
... in the near future Abbreviations ACT, adoptive cell transfer Competing interests The authors declare that they have no competing interests Authors’ contributions Both authors wrote the article ... addition, there are many other factors that limit the use of adoptive T- cell therapy for cancer For example, the failure of adoptive immuno therapy against cancers lies in the absence of tumorspecific ... central memory T cells with this system In vitro results showed that the population of live central memory T cells increased by 24% and that apoptotic cell popu lation was decreased by 54% in the...
- 3
- 239
- 0
Tài liệu Báo cáo khoa học: The pro-form of BMP-2 interferes with BMP-2 signalling by competing with BMP-2 for IA receptor binding pptx
Ngày tải lên :
18/02/2014, 06:20
... indirect conclusions about the position of the pro-peptide with respect to the mature part As neither the interaction with BMPR-IA nor with noggin was affected in quantitative terms, the pro-peptide ... constants for interaction of the ECD of BMPR-IA with the growth factors Association (ka) and dissociation (kd) rates for the ligands with the ECD and the apparent dissociation constants KD as determined ... appears not to alter significantly the activity of the mature part [17] For the pro-peptide of BMP-7, a targeting role to the extracellular matrix [18] has been shown The pro-peptide of BMP-4 is...
- 13
- 892
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... is still very limited [1] The early finding that most of the stressors and agents with the ability to induce HSPs appeared to be proteotoxic gave rise to the suggestion that protein denaturation ... response at the normal growth temperature, as highlighted by monitoring of the synthesis of the major HSP, HSP-70 The critical concentrations of each of the two fluidizers were selected so that their ... be the sole initiating signal for the activation of HSP genes [24] In the course of the present study, we treated K562 cells with BA or HE at concentrations that induce a heat shock response at...
- 10
- 452
- 0
Báo cáo khoa học: On the aggregation properties of FMRP – a link with the FXTAS syndrome? pot
Ngày tải lên :
14/03/2014, 23:20
... components of the inclusions, we cannot exclude at this stage that its absence is not simply due to lack of sensitivity of the detection methods used We suggest as a working hypothesis that the aggregative ... similarity) N-terminal half of the proteins which is also the region involved in most of the interactions with the FXR cellular partners [30], suggesting that the aggregation hot-spots could ... not, however, complete during the time course of the experiment (3 h) This suggests that, under the same experimental conditions, the region C-terminal to the NDF, comprising the linker between...
- 10
- 415
- 0
Báo cáo khoa học: Alterations in the photoactivation pathway of rhodopsin mutants associated with retinitis pigmentosa potx
Ngày tải lên :
22/03/2014, 16:20
... G89D mutants were studied in the context of the folding and packing of the TM domain together with other adRP mutations in the other TM helices [20] These studies showed that G51V was able to regenerate ... stable compared with WT rhodopsin, both in the dark and after photoactivation Both the stability of the mutants and their ability to activate Gt could be correlated with the increase in size of ... exhibit less stable active photointermediates that would contribute to the reduced degree of Gt activation observed In terms of the thermal stability, the active 1496 In order to dissect further the...
- 13
- 428
- 0
buede - the engineering design of systems - models and methods 2e (wiley, 2009)
Ngày tải lên :
03/04/2014, 12:22
... initiated at the top left of the Vee with the definition of the operational need of the stakeholders The focus of the decomposition and definition process (or design) is the movement from an operational ... requirements that state the needs of the stakeholders for qualifying the design of the system These requirements form the basis of the problem definition for creating the qualification system that will ... detail The first cycle satisfies the key elements of stakeholder satisfaction, beginning with the determination of the need and ending with the delivery of the system to satisfy those needs The...
- 524
- 360
- 0
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx
Ngày tải lên :
18/06/2014, 15:20
... clonotypes of melanoma patients Further biases were the frequent association of this public motif with TRBV28 and TRBJ1-5 segments and the lack of rearrangement with members of TRBJ2 cluster The ... Conclusion The finding of a conserved amino acid motif in the CDR3, together with the selective use of certain TRBJ and TRBV segments, indicates an important role of the TRB chain in fine-tuning TR affinity ... Frequent contribution of T cell clonotypes with public TCR features to the chronic response against a dominant EBV-derived epitope: application to direct detection of their molecular imprint on the...
- 14
- 532
- 1
Báo cáo hóa học: " Comparison of T-cell receptor repertoire restriction in blood and tumor tissue of colorectal cancer patients" docx
Ngày tải lên :
18/06/2014, 16:20
... study was the application of mathematical markers to describe the global restriction of the αβ TCR repertoire in the different compartments rather than the detection of single expanded T- cell clones ... measurements and analyses NCN collected samples and participated in the conduct of the study ET participated in design and conduct of the study UK participated in design and conduct of the study DN ... degradation were excluded from further analysis The aim of our study was the detection of TCR repertoire restriction due to T- cell expansions associated with significant TCR expression of the expanded...
- 9
- 416
- 0