the operative factor of a passive building model

... 20% of the area needs high thermal care 80% of the area needs low and middle thermal care Bath room 80% of the area needs high thermal care 20% of the area needs middle thermal care Table The ... Insulation – The Operative Factor of a Passive Building Model islands have been abundantly addressed throughout decades in urban areas with an extensive variety of climates and landscapes (Amjad Al-musaed ... room Thermal care level 80% of the area needs high thermal care 20% of the area needs middle thermal care Bed room 85% of the area needs high thermal care 15% of the area needs middle thermal care...

Ngày tải lên: 28/06/2014, 17:20

... diagram of the application of a nonlinear canceler of the hybrid echo for an ADSL transceiver system tones in the input signal and of a finite number of samples for the estimation of the model parameters ... [n] The Cramer-Rao bound is the theoretical lower bound for ˆ the variance of all unbiased estimators θ for the model parameters θ and is determined by the diagonal elements of the inverse of the ... variance σu = 0.64 The figure reveals that there is a high covariance between the linear parameters and the third-order parameters That corresponds to the known fact that even in the case of a...

Ngày tải lên: 23/06/2014, 01:20

... the per capita birth rate of the population, µ is the per capita disease-free death rate and ρ is the excess per capita death rate of infective class, β is the effective per capita contact rate, ... individuals who are capable of contracting the disease and becoming infective, • (I), the infective class, i.e., the class of those individuals who are capable of transmitting the disease to others, ... implies the ergodicity of the diffusion as well as the convergence in total variation of the transition probability to the invariant measure (see [6, 15]) As a result we have the following theorem...

Ngày tải lên: 12/10/2015, 10:41

... This Carreau model has the advantage that it correctly reflects the actual material behavior over a broader shear-rate range than that afforded by the power law, and that it also yields meaningful ... gate This means that, above all, a flow path close to the wall remains there At the point of branching, the core material penetrates against the opposite wall and lingers there afterwards (Figure ... holding-pressure phase has almost no effect in the gate area The material rapidly attains the mold temperature in the (usually) small cross-section of the gate anyway and, with this, the maximum curing...

Ngày tải lên: 13/10/2016, 22:33

... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...

Ngày tải lên: 06/09/2013, 05:48

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... different model on the Lancaster Treebank data set The models used in this evaluation were trained with observation data from the Lancaster Treebank training set The training set and testing set are...

Ngày tải lên: 08/03/2014, 02:21

... are those used by the US Department of Health and Human Services [51] These rates and appropriate standards can be set as parameters, as the model is an instrument that allows Page of the Health ... liberal immigration policies, it had the highest population growth rate of the European Union, with an average annual increase of 1.6% and a Page of total increase of 15%, leading to a great increase ... identifies the structures and interactions of feedback loops, and consists of variables for cause and effect, and causal links A causal link connects a cause variable with an effect variable by a link...

Ngày tải lên: 18/06/2014, 17:20

... Evolution of the ATP transporter family based on available amino acid sequences from a range of microsporidian parasites 1, Putative ancestral duplication of ATP transporters within the microsporidia ... nothing about the overall organization of the genome because the fragments sampled were small and only a tiny fraction of the genome was characterized in any one case [35,36,38] The data presented ... uncultivatable organisms from which only a handful of contaminant-free DNA can be extracted Finally, an important goal of the present study was to gather a large amount of genome sequence information...

Ngày tải lên: 09/08/2014, 20:20

... site of infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, but have adverse ... Withaferin A (WFA), a steroidal lactone isolated from the herb Withania somnifera (also known as Indian Ginseng and Ashwagandha), which is widely used in traditional Indian medicine as an antiinflammatory ... Withania somnifera (ashwagandha): a review Altern Med Rev 2000, 5:334-346 Bargagna-Mohan P, Ravindranath PP, Mohan R: Small molecule anti-angiogenic probes of the ubiquitin proteasome pathway:...

Ngày tải lên: 11/08/2014, 08:22

... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... responsible for the pattern observed in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed ... complex as a cofactor, the virus may assure an optimal cellular environment for maximal virus production Further analysis of the genes regulated by cyclin T1 may lead to the identification of additional...

Ngày tải lên: 13/08/2014, 09:20

... Equations 1-4 except for subscripts: As (t) = A0 e−kaat (27) kaa ( e−kaat − e−kadt ) kad − kaa (28)  kaa  kad Ad (t) = A0  e−kad t − e−kaat +1 kad − kaa  kad − kaa  (29) Aa (t) = A0 On the ... of the parameters t1 and t99 was motivated in large part by the availability of such data in the literature, but also by the importance of t1 as a defining timescale of the behavior of populations ... detailed quantitative historical data that explicitly included a PTC as part of the response to a disaster became available, the model could be fit to these data and estimates of the model parameters...

Ngày tải lên: 13/08/2014, 16:20

... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised the drafting and editing of manuscript All authors reviewed...

Ngày tải lên: 14/08/2014, 08:20

... repeats are apparently translated to form poly-asparagine, which makes up a substantial fraction of some proteins The description of the whole genome allows the large scale of these repeats in ... amoeba whose genome has recently been sequenced [5] Entamoeba is an intestinal parasite of mammals, causing diseases such as amoebic dysentery - an antisocial amoeba to Dictyostelium’s social amoeba, ... from the animal lineage before fungi and yeasts, but after plants From the point of view of its use as a model organism, the evolutionary distance between Dictyostelium and human is actually...

Ngày tải lên: 14/08/2014, 14:21

... efficiently handle a wide variety of variables, constraints are easily added or changed, and they guarantee the optimal answer given valid assumptions and accurate data Hence, additional constraints and ... problematic (the matrix approach) Conversely, optimization models can handle a wide variety of variables, easily accommodate additional constraints, and guarantee the optimal answer given valid assumptions ... products as a bundle of attributes, Baumol and Vinod’s (1970) model enables researchers to determine the impact of a change in the value of an attribute, which gives their model a great deal of flexibility...

Ngày tải lên: 02/11/2014, 00:50

... a market then the reasons favouring one rather than the other are probably marginal Of course, if a group of open air dining spaces were under a wide span canopy, radiant heaters to each space ... turbulent in a large space than a small one I would like to see light admitted as a series of discrete, transparent areas rather than an overall diffusing surfaces Then the opaque areas can be properly ... representation of convective turbulence, but it is not able to model the momentum of incoming air, nor the thermal capacity of the bounding surfaces Fig Air flows in the National Theatre Then at the...

Ngày tải lên: 09/06/2015, 17:22

... experimental data and the numerical results of Jayah et al [8] The shape of the curve is similar to that obtained by Jayah et al [8] and other previous papers [7,8,14] The temperature decreases along the ... experimental data using an exponential variation for the bio-char reactivity factor and an effectiveness factor Simulations have been carried out and it was shown that the loading of the gasification ... bio-char particles in the gasification zone is not total and a residual mass fraction is retained at the bottom of the gasifier as shown in the experimental work of Jayah et al [8] The residual mass...

Ngày tải lên: 01/08/2016, 09:31

... Spodumene mines can be found in Sweden, Austria, Brazil, Argentina, Canada, Australia, Russia, etc., some of which may or may not be operational (Kunasz, 2006) Australia appears to have the largest spodumene ... below The table compiles the data from the available basins in the world and shows the geologic factor pertaining to each The basic brine basin information table below is taken from the journal article ... reducing the amount of anode in comparison to cathode and can achieve the theoretical capacity of 750 milliAmphours/gram; twice that of the LiC6 composition (Gaines and 23 Cuenca, 2000) Additional...

Ngày tải lên: 10/12/2016, 09:56

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

Ngày tải lên: 27/10/2012, 16:51

... considers the initial costs and all other future costs and discounts them to their present value The salvage value of the system was taken to be 20% of the initial cost of the BIPV generator Maintenance ... than in Africa, with Japan, USA and China entering the market recently The PV market has not grown to expected levels in South Africa other than a few rural or far off-grid solar home system applications ... findings of Ren, Gao and Ruan [25] who reported that annual cost-savings ratio is maximum at PV capacity of about 1kW and starts decreasing thereafter due to increased costs of balance of system components...

Ngày tải lên: 05/09/2013, 16:10

... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... on the exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated ... graduate Thermodynamics in the Department of Mechanical Engineering at UFRJ He is a member of the Brazilian Society of Mechanical Sciences and Engineering (ABCM) and of the American Institute of...

Ngày tải lên: 05/09/2013, 16:30