the necessity of a cognitive base
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx
... clearly consider CSM as an activity that is based on standardized questionnaires that are delivered to a sample of the customer base These quantitative multi-attribute questionnaires are then analyzed ... and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... important to differentiate whether CSM is focusing on the satisfaction of the customer organization as a whole or the satisfaction of certain individuals within that organization These are clearly...
- 37
- 1,063
- 0
báo cáo hóa học:" India-US collaboration to prevent adolescent HIV infection: the feasibility of a family-based HIV-prevention intervention for rural Indian youth" pot
... Guilamo-Ramos, as principal investigators, had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis The study was designed ... for all participants [35,40] As the pada lacked a common space, the girls and the mothers groups met in the house of the pada worker, and the boys and fathers groups met in the house of the angan- ... "They are outside and they feel it is a need so they have sexual relationships." one father said Feasibility of a family-based programme All four groups of stakeholders indicated that a familybased...
- 13
- 504
- 0
The impact of a genre-based approach on 11th students’ writing performance An action research at Tuyen Quang Gifted High School, Tuyen Quang
... 2 Aims and objectives of the research The research is aimed at investigating students‘ attitudes towards the genre-based approach, which was new to them, and examining whether this teaching approach ... Tuyen Quang, Vietnam The research lasted for weeks and the treatment was applied to all students in a classroom The research mainly focused on 11th form students majored in Mathematics The research ... research method was aimed at providing information on students‘ attitudes towards, and opinions about, the genre-based approach that their teacher (also the researcher) used In addition to the...
- 5
- 548
- 6
2012 Partnering to Seal-A-Smile A report on the success of Wisconsin school-based dental sealant programs. pot
... also are provided at a dental clinic operated by the program The program targets all children at area schools Program data was not available upon request for the 2009 and 2010 school years Partnering ... at the City of West Allis Health Department The coordinator provides oral exams, sealants, fluoride varnish applications and oral health education The program was a longtime grantee of the SAS ... treatment n /a Oral health education n /a Untreated decay n /a Urgent needs n /a Retention rate n /a Program notes The program is coordinated by a project manager at Northeast Wisconsin Area Health Education...
- 72
- 411
- 0
Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx
... labelling, but they are not available in the output of other parsers As an alternative to hardcoded heuristics, Blaheta and Charniak (2000) proposed to recover the Penn functional tags automatically ... pattern and the features of all the nodes involved We trained a separate classifier for each pattern For evaluation purposes we extracted all occurrences of the patterns and the features of their ... automatically enrich the output of a parser with information that is not provided by the parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and...
- 8
- 379
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG ... GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers used for amplification of the Bov-B LINE retroposon; ... PLA3G1 (R) PLA5G2 (F) PLA3G2 (R) PLA3G4 (R) ARTFa (F) ARTRa (R) AtxBFb (F) AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC...
- 10
- 451
- 0
DELIVERING HEALTH EDUCATION VIA THE WEB: DESIGN AND FORMATIVE EVALUATION OF A DISCOURSE-BASED LEARNING ENVIRONMENT pot
... experienced while navigating through the site A suggested enhancement to the navigational capability of the site was a text-based replication of site navigation bar at the top of each page to make scrolling ... Web learning environment These icons were replicated at the top left corner of the corresponding page and again in a navigational menu bar that appears at the bottom of each page allowing the student ... page The earlier version of the ‘Discussion Area’ was maintained, however, based on reviewers suggestions, an abbreviated list of the group tasks was added to the top of the Discussion Area page...
- 12
- 411
- 0
báo cáo hóa học: " Doubtful outcome of the validation of the Rome II questionnaire: validation of a symptom based diagnostic tool" doc
... was the mentor of LK and participated in the face validity process of the translation LK also participated in the writing of the manuscript LA had the comprehensive responsibility for the main ... Bolling-Sternevald E, Junghard O, Talley NJ, Agreus L: Gatro-oesophageal reflux symptoms and health-related quality of life in the adult general population -the Kalixanda study Aliment Pharmacol Ther 2006, ... English words as abdomen, stomach, and pain can be accurately translated into Swedish in various ways We compared the back-translation with the original English version and found a few variations in...
- 9
- 524
- 0
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
... designed and managed the valuation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript All authors read and approved the final manuscript Acknowledgements ... providing the descriptive system is valued on the same scale using the same variant of the same valuation technique, as was the case for the CAMPHOR and EQ-5D models, then the valuations should ... conducted analysis and reported on the valuation exercise *DM ran the analysis to identify items for the valuation exercise, analysed the validation data and contributed to the writing of the manuscript...
- 8
- 590
- 0
báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx
... respond to items and talk about all aspects of their health and well-being in meaningful ways They are able to comprehend varying response options on a categorical scale, and can accurately respond ... using a 7-day recall period Feedback from the children who participated was valuable in creating a set of items to be administered to a wide age range of children The final item set generated as a ... for an interview date At the time of the interview, a trained research assistant obtained parental informed consent and the children signed an assent document All child participants received a...
- 10
- 480
- 1
báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx
... displacement to estimate the amount of postural sway in the AP plane Scores are calculated as the angular difference, expressed as a percentage, between the amount of estimated AP postural sway and ... not by a reallocation of attention but by mechanical destabilization, albeit along a temporal rather than a spatial dimension, brought about by articulation and respiratory patterns during the spoken ... our purpose, RMS was calculated for each test trial as the square root of the mean squared deviation from the average COP value Separate RMS values were calculated for the COP AP and ML time series...
- 7
- 603
- 0
báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx
... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant into the ... biomechanical test set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design of the study and performed ... destruction of the ligaments, capsules and soft tissue Soft tissue was only removed from the upper half of the cranial vertebral body and the lower half of the caudal vertebral body The upper and lower...
- 9
- 457
- 0
Báo cáo hóa học: "On the feasibility of a channel-dependent scheduling for the SC-FDMA in 3GPP-LTE (mobile environment) based on a prioritizedbifacet Hungarian method" doc
... out of the scope of this research work) Page of 10 the urban area was utilized for this purpose The time delay and the corresponding average powers in the case of a 12 tap configuration are shown ... important aspect to consider is that in the case of the first one, as the size of the input matrix increases then the number of branches also increases by two (e.g., × matrix = branches, while a ... perceiving the dynamic allocation Lately, for each of the optimal metrics provided as output of the algorithm, the global metrics were computed with the aim of generating a statistical distribution,...
- 10
- 496
- 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx
... which generate estimates of the noise covariance matrix with more variance when primary data are used More precisely, the variance of the noise covariance matrix estimate and then the associated performance ... R(nT), C(nT), s TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR No TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR - 29 - Receivers ... (called primary observation vectors) For example the secondary observation vectors may correspond to samples of data associated with another range than the range of the detected target in radar...
- 45
- 467
- 0
Báo cáo hóa học: "Research Article A Modified Run-Length Coding towards the Realization of a RRO-NRDPWT-Based ECG Data Compression System" pdf
... performance Several experiments are also taken by using the MIT-BIH arrhythmia database [13] The rest of this paper is organized as follows The nonlinear quantization scheme with the approximate ... of subband error The two mechanisms facilitate the significant normalization of subband data and a quantization scheme design with linear distortion characteristics EURASIP Journal on Advances ... (4), QF can be an available variable for desired PRD and CR control In order to explore the linear control performance of QF, all 48 ECG signals recorded in the MIT-BIH arrhythmia database were...
- 8
- 394
- 0
Báo cáo hóa học: " Research Article Impact of LQI-Based Routing Metrics on the Performance of a One-to-One Routing Protocol for IEEE 802.15.4 Multihop Networks" docx
... the calculation of the cost of a path, based on the LQI values of all links Therefore, we chose to evaluate the performance of these LQI-based routing metrics for NST-AODV Note that the PATH-DR ... packet were obtained at each of the remaining motes The LDR was calculated for all the receivers The same procedure was repeated three times, and the sender was placed at each of the other three ... including the LQI of lost packets [19] 6.2 Variability of the LQI of a Link Figure depicts the standard deviation of the LQI against the average values of LDR (%) EURASIP Journal on Wireless Communications...
- 20
- 397
- 0
Báo cáo hóa học: "Research Article The Solvability of a Class of General Nonlinear Implicit Variational Inequalities Based on Perturbed Three-Step Iterative Processes with Errors" potx
... Siddiqi and Q H Ansari, “Strongly nonlinear quasivariational inequalities,” Journal of Mathematical Analysis and Applications, vol 149, no 2, pp 444–450, 1990 22 A H Siddiqi and Q H Ansari, “General ... nonlinear variational inequalities,” Journal of Mathematical Analysis and Applications, vol 166, no 2, pp 386–392, 1992 23 L U Uko, “Strongly nonlinear generalized equations,” Journal of Mathematical ... S Adly, “Perturbed algorithms and sensitivity analysis for a general class of variational inclusions,” Journal of Mathematical Analysis and Applications, vol 201, no 2, pp 609–630, 1996 C Baiocchi...
- 13
- 251
- 0
Báo cáo lâm nghiệp: "Assessment of the assortment potential of the growing stock – a photogrammetry based approach for an automatized grading of sample trees" potx
... of the assortment criteria for the grading routine, a database application thar-QDB (Tharandt Quality Data Base) was developed as subject-matter of a diploma thesis [19] The grading process was ... (breast height) and the basal areas of first green/dead branch can serve as “natural pass points” for supporting a rectification of the stem part > m height Finally, the geo-coordinates of the sample ... (iv) a marketoriented evaluation approach for the growing stock The article reports primarily the results of the photogrammetrical investigation and the automatized grading A total of eight Norway...
- 10
- 359
- 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/4 2A ... '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 B2 redaeL SERI noigeR seborp dna sremirp cificeps-VDMF...
- 6
- 347
- 0
Báo cáo y học: "The validity of a rheumatoid arthritis medical records-based index of severity compared with the DAS28" docx
... data were assumed to be the absence of the extra-articular manifestation for pulmonary nodule When radiologic and laboratory data were not available, the data was considered as missing ACR, American ... USA) Statistical analysis To test the convergent validity of RARBIS as a measure of disease severity, the Spearman rank correlation between the RARBIS and the DAS28 was assessed in the total study ... coefficients of a linear regression of all subscales on the DAS28 Results Patients characteristics and the RARBIS score Patient characteristics of the study cohort are summarized in Table The mean age of...
- 7
- 365
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008