the necessity of a cognitive base

... clearly consider CSM as an activity that is based on standardized questionnaires that are delivered to a sample of the customer base These quantitative multi-attribute questionnaires are then analyzed ... and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... important to differentiate whether CSM is focusing on the satisfaction of the customer organization as a whole or the satisfaction of certain individuals within that organization These are clearly...

Ngày tải lên: 15/01/2014, 15:59

... Guilamo-Ramos, as principal investigators, had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis The study was designed ... for all participants [35,40] As the pada lacked a common space, the girls and the mothers groups met in the house of the pada worker, and the boys and fathers groups met in the house of the angan- ... "They are outside and they feel it is a need so they have sexual relationships." one father said Feasibility of a family-based programme All four groups of stakeholders indicated that a familybased...

Ngày tải lên: 20/06/2014, 08:20

... 2 Aims and objectives of the research The research is aimed at investigating students‘ attitudes towards the genre-based approach, which was new to them, and examining whether this teaching approach ... Tuyen Quang, Vietnam The research lasted for weeks and the treatment was applied to all students in a classroom The research mainly focused on 11th form students majored in Mathematics The research ... research method was aimed at providing information on students‘ attitudes towards, and opinions about, the genre-based approach that their teacher (also the researcher) used In addition to the...

Ngày tải lên: 04/08/2015, 09:41

... also are provided at a dental clinic operated by the program The program targets all children at area schools Program data was not available upon request for the 2009 and 2010 school years Partnering ... at the City of West Allis Health Department The coordinator provides oral exams, sealants, fluoride varnish applications and oral health education The program was a longtime grantee of the SAS ... treatment n /a Oral health education n /a Untreated decay n /a Urgent needs n /a Retention rate n /a Program notes The program is coordinated by a project manager at Northeast Wisconsin Area Health Education...

Ngày tải lên: 07/03/2014, 04:20

... labelling, but they are not available in the output of other parsers As an alternative to hardcoded heuristics, Blaheta and Charniak (2000) proposed to recover the Penn functional tags automatically ... pattern and the features of all the nodes involved We trained a separate classifier for each pattern For evaluation purposes we extracted all occurrences of the patterns and the features of their ... automatically enrich the output of a parser with information that is not provided by the parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and...

Ngày tải lên: 08/03/2014, 04:22

... CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG ... GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers used for amplification of the Bov-B LINE retroposon; ... PLA3G1 (R) PLA5G2 (F) PLA3G2 (R) PLA3G4 (R) ARTFa (F) ARTRa (R) AtxBFb (F) AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC...

Ngày tải lên: 17/03/2014, 03:20

... experienced while navigating through the site A suggested enhancement to the navigational capability of the site was a text-based replication of site navigation bar at the top of each page to make scrolling ... Web learning environment These icons were replicated at the top left corner of the corresponding page and again in a navigational menu bar that appears at the bottom of each page allowing the student ... page The earlier version of the ‘Discussion Area’ was maintained, however, based on reviewers suggestions, an abbreviated list of the group tasks was added to the top of the Discussion Area page...

Ngày tải lên: 28/03/2014, 21:20

... was the mentor of LK and participated in the face validity process of the translation LK also participated in the writing of the manuscript LA had the comprehensive responsibility for the main ... Bolling-Sternevald E, Junghard O, Talley NJ, Agreus L: Gatro-oesophageal reflux symptoms and health-related quality of life in the adult general population -the Kalixanda study Aliment Pharmacol Ther 2006, ... English words as abdomen, stomach, and pain can be accurately translated into Swedish in various ways We compared the back-translation with the original English version and found a few variations in...

Ngày tải lên: 18/06/2014, 19:20

... designed and managed the valuation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript All authors read and approved the final manuscript Acknowledgements ... providing the descriptive system is valued on the same scale using the same variant of the same valuation technique, as was the case for the CAMPHOR and EQ-5D models, then the valuations should ... conducted analysis and reported on the valuation exercise *DM ran the analysis to identify items for the valuation exercise, analysed the validation data and contributed to the writing of the manuscript...

Ngày tải lên: 18/06/2014, 19:20

... respond to items and talk about all aspects of their health and well-being in meaningful ways They are able to comprehend varying response options on a categorical scale, and can accurately respond ... using a 7-day recall period Feedback from the children who participated was valuable in creating a set of items to be administered to a wide age range of children The final item set generated as a ... for an interview date At the time of the interview, a trained research assistant obtained parental informed consent and the children signed an assent document All child participants received a...

Ngày tải lên: 18/06/2014, 19:20

... displacement to estimate the amount of postural sway in the AP plane Scores are calculated as the angular difference, expressed as a percentage, between the amount of estimated AP postural sway and ... not by a reallocation of attention but by mechanical destabilization, albeit along a temporal rather than a spatial dimension, brought about by articulation and respiratory patterns during the spoken ... our purpose, RMS was calculated for each test trial as the square root of the mean squared deviation from the average COP value Separate RMS values were calculated for the COP AP and ML time series...

Ngày tải lên: 19/06/2014, 10:20

... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant into the ... biomechanical test set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design of the study and performed ... destruction of the ligaments, capsules and soft tissue Soft tissue was only removed from the upper half of the cranial vertebral body and the lower half of the caudal vertebral body The upper and lower...

Ngày tải lên: 20/06/2014, 04:20

... out of the scope of this research work) Page of 10 the urban area was utilized for this purpose The time delay and the corresponding average powers in the case of a 12 tap configuration are shown ... important aspect to consider is that in the case of the first one, as the size of the input matrix increases then the number of branches also increases by two (e.g., × matrix = branches, while a ... perceiving the dynamic allocation Lately, for each of the optimal metrics provided as output of the algorithm, the global metrics were computed with the aim of generating a statistical distribution,...

Ngày tải lên: 21/06/2014, 00:20

... which generate estimates of the noise covariance matrix with more variance when primary data are used More precisely, the variance of the noise covariance matrix estimate and then the associated performance ... R(nT), C(nT), s TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR No TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR - 29 - Receivers ... (called primary observation vectors) For example the secondary observation vectors may correspond to samples of data associated with another range than the range of the detected target in radar...

Ngày tải lên: 21/06/2014, 00:20

... performance Several experiments are also taken by using the MIT-BIH arrhythmia database [13] The rest of this paper is organized as follows The nonlinear quantization scheme with the approximate ... of subband error The two mechanisms facilitate the significant normalization of subband data and a quantization scheme design with linear distortion characteristics EURASIP Journal on Advances ... (4), QF can be an available variable for desired PRD and CR control In order to explore the linear control performance of QF, all 48 ECG signals recorded in the MIT-BIH arrhythmia database were...

Ngày tải lên: 21/06/2014, 05:20

... the calculation of the cost of a path, based on the LQI values of all links Therefore, we chose to evaluate the performance of these LQI-based routing metrics for NST-AODV Note that the PATH-DR ... packet were obtained at each of the remaining motes The LDR was calculated for all the receivers The same procedure was repeated three times, and the sender was placed at each of the other three ... including the LQI of lost packets [19] 6.2 Variability of the LQI of a Link Figure depicts the standard deviation of the LQI against the average values of LDR (%) EURASIP Journal on Wireless Communications...

Ngày tải lên: 21/06/2014, 11:20

... Siddiqi and Q H Ansari, “Strongly nonlinear quasivariational inequalities,” Journal of Mathematical Analysis and Applications, vol 149, no 2, pp 444–450, 1990 22 A H Siddiqi and Q H Ansari, “General ... nonlinear variational inequalities,” Journal of Mathematical Analysis and Applications, vol 166, no 2, pp 386–392, 1992 23 L U Uko, “Strongly nonlinear generalized equations,” Journal of Mathematical ... S Adly, “Perturbed algorithms and sensitivity analysis for a general class of variational inclusions,” Journal of Mathematical Analysis and Applications, vol 201, no 2, pp 609–630, 1996 C Baiocchi...

Ngày tải lên: 21/06/2014, 22:20

... of the assortment criteria for the grading routine, a database application thar-QDB (Tharandt Quality Data Base) was developed as subject-matter of a diploma thesis [19] The grading process was ... (breast height) and the basal areas of first green/dead branch can serve as “natural pass points” for supporting a rectification of the stem part > m height Finally, the geo-coordinates of the sample ... (iv) a marketoriented evaluation approach for the growing stock The article reports primarily the results of the photogrammetrical investigation and the automatized grading A total of eight Norway...

Ngày tải lên: 07/08/2014, 16:20

... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/4 2A ... '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 B2 redaeL SERI noigeR seborp dna sremirp cificeps-VDMF...

Ngày tải lên: 07/08/2014, 18:21

... data were assumed to be the absence of the extra-articular manifestation for pulmonary nodule When radiologic and laboratory data were not available, the data was considered as missing ACR, American ... USA) Statistical analysis To test the convergent validity of RARBIS as a measure of disease severity, the Spearman rank correlation between the RARBIS and the DAS28 was assessed in the total study ... coefficients of a linear regression of all subscales on the DAS28 Results Patients characteristics and the RARBIS score Patient characteristics of the study cohort are summarized in Table The mean age of...

Ngày tải lên: 09/08/2014, 07:20