the most common reasons for emergency psychiatric evaluation

using the common criteria for it security evaluation

using the common criteria for it security evaluation

... Chapter puts the book in context by explaining the purpose for which the book was written Limitations on the scope of the subject matter of the book, the intended audience for whom the book was ... efforts have been made to publish reliable data and information, but the author and the publisher cannot assume responsibility for the validity of all materials or for the consequences of their ... Discussing the CC user community and stakeholders Ⅲ Looking at the future of the CC 2.0 History The Common Criteria, referred to as the standard for information security,”117 represent the culmination...

Ngày tải lên: 03/06/2014, 01:30

284 1,4K 0
The Most Common Inpatient Problems in Internal Medicine pdf

The Most Common Inpatient Problems in Internal Medicine pdf

... subtlety, they have captured the key aspects of modern therapeutics in chapters addressing the most frequent and, therefore, most important acute medical problems The text is organized for clarity, ... brother-in-law, Daniel, for their encouragement and love Most of all, he thanks his wife, Sarah, for her unselfish, unwavering, and unconditional love and support v Foreword According to the ... Rustgi for their outstanding teaching and mentorship He also thanks his parents, his brother, Alan, and his extended family for their encouragement Most importantly, he thanks his wife, Yumee, for...

Ngày tải lên: 06/03/2014, 12:20

410 2,4K 7
HPV is the most common sexually transmitted infection (STI)

HPV is the most common sexually transmitted infection (STI)

... a host cell and take over the cell activities, eventually causing destruction of the cell and killing it (The virus enters a cell, makes copies of itself and causes the cell to burst releasing ... certain cell types They are said to be specific Example: The rabies virus only attacks brain or nervous cells Surface Markers Virus Receptor Sites It’s like the pieces of a puzzle The ends have to ... either DNA or RNA but NOT both Viruses with RNA that transcribe into DNA are called retroviruses Viruses are parasites—an organism that depends entirely upon another living organism (a host) for...

Ngày tải lên: 15/03/2014, 13:03

15 671 0
báo cáo hóa học:" Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer subtypes" pdf

báo cáo hóa học:" Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer subtypes" pdf

... cultured for a further 48 hr The culture supernatants were collected and microfuged at 1,500 rpm for five to remove particles and the supernatants frozen at -20°C until use in ELISA The concentration ... was used as internal control The forward sequence GAATGACgCCCTCAATCAAAGT and reverse sequence TCATCTTGGGCAGTCACATACA were used for human IL-Ra For human IL1RA, the forward and reverse sequences ... cells This is of further interest given that this subtype of ovarian cancer represents the major and the one of most commonly associated to endometriosis [2,3] One could hypothesize that after...

Ngày tải lên: 20/06/2014, 07:20

8 494 0
Báo cáo y học: "Pre-existing disease: the most important factor for health related quality of life long-term after critical illness: a prospective, longitudinal, multicentre trial" docx

Báo cáo y học: "Pre-existing disease: the most important factor for health related quality of life long-term after critical illness: a prospective, longitudinal, multicentre trial" docx

... lastly, the overall most important factor for the decreased HRQoL reported by the patients in the long term was their pre-existing diseases Page of 10 three ICUs are emergencies and the most common ... We are also grateful to the Linquest Group at the Centre for Public Health at the County Council of Östergötland for providing access to the data for the reference group The present study is supported, ... only for age and sex then leads to a faulty interpretation of the HRQoL values among former ICU patients as their HRQoL may be assumed to be lower prior to the admittance to the ICU due to their...

Ngày tải lên: 13/08/2014, 20:21

10 330 0
Risk governance deficits an analysis and illustration of the most common

Risk governance deficits an analysis and illustration of the most common

... industry the concept of risk governance deficits, to list and describe the most common deficits, to explain how they can occur, to illustrate them and their consequences, and to provide a catalyst for ... experts and reporters long before the crisis occurred For example, as early as 2000, the former Federal Reserve governor, Dr Edward M Gramlich, warned the then chairman of the Federal Reserve Board, ... maintained for so long had the federal regulators been able to fully understand the complex dynamics of the system, the nature of the housing bubble and the probability that it would burst, and the...

Ngày tải lên: 18/11/2016, 13:53

92 474 0
Tài liệu [ Team LiB ] Using Contacts for Mail Merge Mail merge is possibly the most popular reason pptx

Tài liệu [ Team LiB ] Using Contacts for Mail Merge Mail merge is possibly the most popular reason pptx

... use the contact data another time or need to keep it for reference, add a check to the Permanent File field and enter a filename When the merge is completed, Outlook will save the file Select the ... include in the merge, you don't need to redo it Uncheck the contacts you don't want included or filter the contacts by selecting the arrows beside the field names, as described in the next section ... want to use, you can change the merge options after the contact data is loaded into Word After you choose OK to begin the merge, Outlook processes the contacts and writes them to a file named OMM*.doc,...

Ngày tải lên: 21/01/2014, 02:20

5 363 0
Tài liệu Laser-Optimized Fiber: Built for Price, Bandwidth, and Distance to Make the Most of Your Investment doc

Tài liệu Laser-Optimized Fiber: Built for Price, Bandwidth, and Distance to Make the Most of Your Investment doc

... refractive index profile of the material, which is calculated as the ratio of the speed of light in a vacuum to the speed of light through the material For example, the refractive index of a vacuum ... Fiber: Built for Price, Bandwidth, and Distance to Make the Most of Your Investment Unfortunately, the use of VCSELs can cause differential mode delay (DMD), an effect that happens when the laser ... receiver to properly identify the signal and therefore reduces transmission capacity (see Figure 1) 10 Gbps 850 nm Laser Core the modal bandwidth This preventsCladding the transmission Core pulse...

Ngày tải lên: 24/01/2014, 11:20

4 461 0
Tài liệu The 1000 Most Common SAT Words pdf

Tài liệu The 1000 Most Common SAT Words pdf

... surprised by the candor of the mayor’s speech because he is usually rather evasive.) canny (adj.) shrewd, careful (The canny runner at the back of the pack through much of the race to watch the other ... encore (n.) the audience’s demand for a repeat performance; also the artist’s performance in response to that demand (At the end of the concert, all the fans yelled, “Encore! Encore!” but the band ... (Because they had worked very hard, the performers appreciated the critic’s lavish praise.) (v.) to give without limits (Because the performers had worked hard, they deserved the praise that the critic...

Ngày tải lên: 26/01/2014, 16:20

71 972 6
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

... other proteins, as evidenced by the accumulation of the precursor form of Toc75 that was sensitive to thermolysin after the import (Fig 4A, lanes 14 and 16; data not shown) The intermediate form ... repeat for the most C-terminal tri-glycine segment (mutant GGA) resulted in proteins being targeted almost equally to the soluble and membrane fractions (Fig 2A, lanes 27, 28; Fig 2B) Most of the ... considered the possibility that the difference between AAG and the other two mutants might be due to kinetics of the import; i.e., AAG precursor might be imported into the stroma more slowly than other...

Ngày tải lên: 19/02/2014, 07:20

9 497 0
The global dimension of water governance: Nine reasons for global arrangements in order to cope with local water problems potx

The global dimension of water governance: Nine reasons for global arrangements in order to cope with local water problems potx

... to the Netherlands for consumption there) The water footprints of people are increasingly externalised to other parts of the world Consumers generally not pay for the negative effects of their ... that provide the meat for the rich cannot be used for other purposes, e.g to fulfil more basic needs of people who however cannot afford to pay The answer to the question of whether the current ... enlarges their water footprint The average meat consumption in the United States for instance is 120 kg/yr, more than three times the world average The water used to produce the feed for the animals...

Ngày tải lên: 23/03/2014, 00:20

36 472 0
Guide for the Selection of Chemical and Biological Decontamination Equipment for Emergency First Responders ppt

Guide for the Selection of Chemical and Biological Decontamination Equipment for Emergency First Responders ppt

... anticipated that the testing, evaluation, and research processes will take several years to complete; therefore, the National Institute of Justice has developed this initial guide for the emergency ... influences the symptoms developed and, to some extent, the sequence of the different symptoms Generally, the poisoning works most rapidly when the agent is absorbed through the respiratory system, rather ... sight, the formation of blisters on the skin, nausea, vomiting, and diarrhea together with severe difficulty in breathing Severe damage to the eye may lead to the total loss of vision The most...

Ngày tải lên: 23/03/2014, 23:20

96 706 0
Guide for the Selection of Chemical and Biological Decontamination Equipment for Emergency First Responders pdf

Guide for the Selection of Chemical and Biological Decontamination Equipment for Emergency First Responders pdf

... II of the Guide for the Selection of Chemical and Biological Decontamination Equipment for Emergency First Responders It contains the information data sheets that were used to support the decontamination ... containing the data sheets for their specific equipment item(s) They were asked to identify missing data and certify the accuracy of the existing data The second contact was made during the first ... contained the data sheets for their specific equipment item(s), the selection factors that were developed to assist with the selection and purchase of the most appropriate equipment, and the results...

Ngày tải lên: 23/03/2014, 23:20

186 601 0
Guide for the Selection of Communication Equipment for Emergency First Responders pot

Guide for the Selection of Communication Equipment for Emergency First Responders pot

... and base radios to extend the range of all of the radios 4.2 Evaluation Results The evaluation results for the communication equipment are presented in tabular format for the 181 items of communication ... between transmissions for their communications without the need to wait for a “clear channel.” Because the computer selects the channel and monitors the repeater before transmitting, the trunked radio ... defined to be the distance between the transmitter and the receiver at which the amplitude of the signal received by the receiver is less than the amplitude of the background noise For example,...

Ngày tải lên: 23/03/2014, 23:20

64 513 0
INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt

INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt

... education they got and what they thought was most important to getting started in their animation career Although professional animators got their education in a variety of different ways, they all ... really learn animation and improve their skills, it was really important to have a mentor Even on the job, most of them continue to learn and advance from the input they get from mentors In fact, ... should reflect that and be a way for them to see what you can One way to judge a school is to look at the quality of the student work Most schools have a show reel of their best students’ work that...

Ngày tải lên: 31/03/2014, 15:20

14 465 0
Work on your idioms - Master the 300 most common idioms

Work on your idioms - Master the 300 most common idioms

... beginning to get the picture get the w rong end of the stick or get hold of the wrong end of the stick If someone gets the wrong end of the stick or gets hold of the wrong end of the stick, they completely ... although the bag really contained a cat If the cat was let out of the bag, then the trick would be exposed 'They didn't tell the cops my name, did they?' 'Of course not,' she said 'They wouldn't ... typing for him a left him in the lurch b treated him like dirt c got the cold shoulder They argue all the time now There's no doubt that their marriage is _ a on fire b on the rocks c their...

Ngày tải lên: 14/05/2014, 16:35

128 1,5K 28
w