the making of a youth culture

... relevant data and constructs the Dow Jones Sustainability Index Once a year, SAM initiates and leads an independent sustainability assessment of approximately 2,250 of the largest corporations around ... Questionnaire, the SAM Corporate Sustainability Assessment is supplemented with a Media and Stakeholder Analysis (MSA) The Media and Stakeholder Analysis allows SAM to identify and assess issues that ... from a multivariate analysis of these governance mechanisms To avoid results overload we construct a variable that summarizes all the mechanisms discussed in Panel A by calculating the percentage...

Ngày tải lên: 06/03/2014, 20:21

... European law ‘Seeing into the mind of law and lawyers’ is not an easy task In particular, and as a part of its integral vocation to remain ‘apart’ from the society that it serves, law is created ... safeguarded by a professionally irreproachable and apolitical cadre of European lawyers The independence and, above all, the professionalism of Europe’s lawyers is also a factor within the following ... ‘constitutionalisation’ is therefore best understood, not as an introspective European act of examination, explanation and analysis of particular postnational assaults on the leading paradigms of modernity,...

Ngày tải lên: 07/03/2014, 02:20

... Attraction’.¹⁰⁴ Perhaps the best-known caricature of the Royal Society, however, is the Academy of Lagado on the island of Laputa (‘whore’ in Italian) a caricature of Bacon’s New Atlantis —in Jonathan Swift’s ... Augustinian Synthesis to Aristotelian Amalgam The Augustinian Synthesis The Transition to a Scholastic Culture The Condemnations of Aristotle The Aristotelian Amalgam Competing Conceptions of Metaphysics ... authority and was an unforgivable sign of disrespect and dissension, the ultimate betrayal of filial piety, of family and clan, and, above all, the betrayal of the principle of jang, yieldingness’ The...

Ngày tải lên: 11/06/2014, 10:28

... consultants have at least a Masters in Business Administration (MBA) Apart from attaining a tertiary qualification, the process of learning, especially at a higher level provides a variety of other ... pathways by which you can become a consultant and build a reputable career The three common pathways are discussed below Superior educational qualifications: Sailing through college and graduating ... you are keen to develop your profile as a high-flying consultant, audit your skills and see where the gaps are Get that additional qualification that can set you apart and propel you to further...

Ngày tải lên: 27/06/2014, 23:20

... mb ro ee ’ s a A ETR EL BTE WHE ? b t lase mb r n akitee u a y rme e a d s, h r w s RSA C EER H s rwt ail bt f t t i lt io a h te PA LN n x s p maea e tt k e WHT O O NE? A D YU ED ak o r l s ... O ITG AIN DPOM N NERT & ELY ET O WH D YU ED O O O NE? a dte ,h k b u n h n ti a o t n AO E LN w cn a as oi e a l y d t tw Ou Ta r e m: Ae l x DSG G Y EIN U Dn a CO E DVLPR LST EE E O Mat rn ... s B A DN & RAIE TAEY R N IG C ET SRTG V IFR AIN R HTCU E NO M T A C I TR O E VS A UDSG IU L IEIN FO T N DVLP ET R N- D EE M N E O TC NC L EER H EPO AIN EH IA RSA C & XLRT O B C - D EE P ET A KE...

Ngày tải lên: 10/07/2014, 14:18

... Money T han God ALSO BY SEBASTIAN MALLABY The World’s Banker: A Story of Failed States, Financial Crises, and the Wealth and Poverty of Nations After Apartheid: The Future of South Africa MORE ... The America of The Great Gatsby had given way to the America of John Steinbeck’s The Grapes of Wrath; the Jazz Age had given way to the Depression On Wall Street, the crash of October 1929 was ... was born in the ninth hour of the ninth day of the ninth month of 1900 a fact with which he would bore his family years later.6 He was the son of an expatriate American who ran the Australian...

Ngày tải lên: 01/11/2014, 21:26

... estimate annual and cumulative defaults 10 Marginal and Cumulative Mortality Rate Equation MMR(t) = Total value of defaulting debt in year (t) total value of the population at the start of the year ... Empresas ICA Sociedad Controladora Grupo Televisa SA Kimberly-Clark de Mexico Telefonos de Mexico SA de CV Vitro SA de CV n .a: not available BBBBB+ BB BB+ Dec 94 n .a AAA BBBABBB AA AAA AAA BB+ ... D AAA BBBBBBBB BBB ABB+ B+ BB BBBBBBBBBBBBAAA AAA BB+ A CCC BBB+ BB+ CCCCCC+ AAA AA BB+ BB+ D A B+ BBBB+ BB+ BB BBB+ BB+ BB BBBB+ BB+ BBBBAA A+ BB+ BB CCCB BB CCC B AABBB+ BB+ BB NR/NR/NR Ba2/NR/NR...

Ngày tải lên: 04/10/2015, 10:26

... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...

Ngày tải lên: 06/09/2013, 05:48

Ngày tải lên: 12/06/2014, 11:36

... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...

Ngày tải lên: 18/06/2014, 22:20

... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...

Ngày tải lên: 20/06/2014, 04:20

... Guilamo-Ramos, as principal investigators, had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis The study was designed ... for all participants [35,40] As the pada lacked a common space, the girls and the mothers groups met in the house of the pada worker, and the boys and fathers groups met in the house of the angan- ... visual images For written materials, parents stressed the importance of addressing illiteracy in the village and of making materials available in multiple languages, e.g., Hindi and Marathi As...

Ngày tải lên: 20/06/2014, 08:20

... between the Tanzanian National Institute for Medical Research, the African Medical and Research Foundation, the ministries of Health and Social Welfare and of Education and Vocational Training of the ... Doyle A, Hayes RJ, Kaballa R: Results and policy implications of two major adolescent sexual and reproductive health trials in Africa: The MEMA kwa Vijana Trial in Tanzania and the Regai Dzive ... Education Officers of Mwanza and the National Directors of National Institute of Medical Research and AMREF for their support Author details National Institute for Medical Research, Mwanza Centre,...

Ngày tải lên: 20/06/2014, 08:20

... Singapore, for his advice, comments, and support at the various stages of the writing of this dissertation I also thank A/ P Yung Sai-shing for reading the first draft of the dissertation and ... of Yuan-ze University, Zhang Deming of Zhejiang University, and Zhou Jianyu of Hong Kong Chinese University for their reading individual chapters of the manuscript I particularly thank Professors ... 中国四十年代现代主义诗潮新论 THE MAKING OF MODERNITY: A STUDY OF THE MODERNIST CHINESE POETRY IN THE 1940S 张松建 ZHANG SONG JIAN (M A ZHEJIANG UNIV.) 新加坡国立大学中文系 博士学位论文 A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY...

Ngày tải lên: 16/09/2015, 15:55

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...

Ngày tải lên: 12/09/2012, 15:05

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... rainfall declined thereafter, Nilo-Saharan speakers may have carried this culture and later the exploitation of grain southward towards Lake Victoria, although there is as yet no archaeological...

Ngày tải lên: 21/09/2012, 10:39

... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...

Ngày tải lên: 02/10/2012, 12:07

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...

Ngày tải lên: 25/10/2012, 11:00