the length of the time interval covered by a sub tree

On optimizing moving object databases

On optimizing moving object databases

... the R -tree are designed for general multidimensional data, an alternative approach of indexing historical data is to take the time as another dimension(s) in additional to the spatial data of objects ... protocol can largely reduce the updating workload of the database, by relaxing the tracking accuracy with care The STSR-based updating protocol guarantees the quality of query answers by pulling passive ... amount of workload the system can handle The workload of a database system consists of two parts, the updates and queries Traditional databases are designed and optimized for relatively static data,...

Ngày tải lên: 09/09/2015, 18:53

245 490 0
Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc

Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc

... at substoichiometric concentrations, and the residuals of the fit from which the KD value was calculated We tested the association of the RbAB domain with a 43-residue N-terminal fragment of the ... understanding of the mechanisms of action of the Rb protein is far behind that of p53, the keeper of the genome, mutated in most cancers and targeted by the same DNA tumor viruses that target the ... extrapolation of two linear fits of the initial and final anisotropy signals For all reactions tested, full saturation was achieved at a : molar ratio of titrant, indicating a : stoichiometry, which validates...

Ngày tải lên: 22/03/2014, 21:20

16 405 0
Báo cáo hóa học: " Research Article Localization of Directional Sound Sources Supported by A Priori Information of the Acoustic Environment" ppt

Báo cáo hóa học: " Research Article Localization of Directional Sound Sources Supported by A Priori Information of the Acoustic Environment" ppt

... Council of Canada, Ottawa, Ontario, Canada, 2002 14 [29] D N Zotkin and R Duraiswami, “Accelerated speech source localization via a hierarchical search of steered response power,” IEEE Transactions ... an additional microphone (right) The source in this example is assumed to be omnidirectional The outstanding features of these maps are their local maxima points Thus a subset of local maxima ... question of spatial resolution of the accumulated correlation maps leads to the problem of time- delay imprecision or misalignment of beamformers [29] The energy map of a beamformer is the visual representation...

Ngày tải lên: 22/06/2014, 19:20

14 313 0
The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf

The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf

... walk a mile than it would to walk a block If such a state of a airs had always existed then primitive man never would have needed to judge that a day’s walk was once again as far as half a day’s ... measurement of things came about There are three general divisions of measurements and these are (1) the measurement of time; (2) the measurement of space and (3) the measurement of matter ; and on these ... thousands column of the original balance leaves 2, which is set down in the thousands column of the new balance, and putting down the remaining of the original balance a new balance is had of $422.61...

Ngày tải lên: 28/06/2014, 19:20

95 383 0
Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot

Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot

... gene was amplified by PCR using the BAC DNA as the template and oligos GGTCGACTTATATATTTATGAACACATTTA and CCCGGGATAACTTCGTATAATGTATGCTATACGAACGGTATCCTGAAATGGGGTCACCACACT The second primer contains ... representation of the 160 kb goat BAC41 insert Localisation of the transcription unit of the two genes are indicated by arrows Length of these transcription units are not at scale The αlac transcription ... and GGTCGACAGCTCACCAGGCCTCCCTGTCCCT Again, this fragment was cloned into pUC 19 and sequenced Lastly, the CAT ORF was released and purified away from the pB9 CAT recombinant plasmid [17] by a...

Ngày tải lên: 14/08/2014, 13:22

9 359 0
Báo cáo sinh học: " Virology on the Internet: the time is right for a new journal" docx

Báo cáo sinh học: " Virology on the Internet: the time is right for a new journal" docx

... Virology Journal 2004, 1:1 Second, the information available to researchers will not be limited by their library's budget, and the widespread availability of articles will enhance literature searching ... countries (and institutions) will be able to read the same material as wealthier ones (although creating access to the Internet is another matter [10]) This is particularly relevant in virology as many ... assign each research manuscript submitted to the journal to a member of the Editorial Board who will be known as the "monitoring editor" The monitoring editor will then appoint at least two ad...

Ngày tải lên: 18/06/2014, 22:20

3 312 0
báo cáo hóa học:" Virology on the Internet: the time is right for a new journal" pdf

báo cáo hóa học:" Virology on the Internet: the time is right for a new journal" pdf

... Virology Journal 2004, 1:1 Second, the information available to researchers will not be limited by their library's budget, and the widespread availability of articles will enhance literature searching ... countries (and institutions) will be able to read the same material as wealthier ones (although creating access to the Internet is another matter [10]) This is particularly relevant in virology as many ... assign each research manuscript submitted to the journal to a member of the Editorial Board who will be known as the "monitoring editor" The monitoring editor will then appoint at least two ad...

Ngày tải lên: 20/06/2014, 04:20

3 334 0
báo cáo hóa học:" Reliability of 95% confidence interval revealed by expected quality-of-life scores: an example of nasopharyngeal carcinoma patients after radiotherapy using EORTC QLQ-C 30" pdf

báo cáo hóa học:" Reliability of 95% confidence interval revealed by expected quality-of-life scores: an example of nasopharyngeal carcinoma patients after radiotherapy using EORTC QLQ-C 30" pdf

... 2Department of Hospital and Health Care Administration, Chia-Nan University of Pharmacy and Science, Tainan, Taiwan, 3School of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan, 4Assessment ... the statistical analysis and wrote the manuscript TW, SJ,WW and LF contributed to the development of the study design and advised on the performance of the statistical analysis The analysis and ... using a Rasch analysis rather than sample and item dependent classical test models For the reason of space limitation for this manuscript, we have not explored the dimensionality and invariance of...

Ngày tải lên: 20/06/2014, 16:20

8 318 0
Báo cáo lâm nghiệp: "Amounts of throughfall and lysimetric water in a sub-mountain beech forest in the Kremnické vrchy Mts" ppt

Báo cáo lâm nghiệp: "Amounts of throughfall and lysimetric water in a sub-mountain beech forest in the Kremnické vrchy Mts" ppt

... belonging to the area of the West Carpathian Mts The species composition is dominated by beech, the stand age is 80–110 years In terms of climate, the plots are situated in moderately warm, moderately ... from the lack of precipitation activity after the treatment – see Dubová (1996) This lady-author evaluated the years after the treatment as extremely dry – below the long-term normal On the other ... in soil layers (Tužinský 1984; Papritz et al 1991) To evaluate the water balance of the examined forest stands, stemflow is an important factor – as already pointed out by Kantor (198 4a) , who...

Ngày tải lên: 07/08/2014, 03:22

5 401 0
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

... cells subjected to the SC-CO2 treatment had disappeared Hong and Pyun (1999, 2001) found that a possible leakage of cytoplasm was caused by the modification of the cell membrane of L plantarum by ... determined the total bacterial count using the standard plate counting method One ml of appropriate dilutions of samples was inoculated in standard plate count agar (Nihon Pharmaceutical Co., Ltd., ... method J Agric Food Chem., 44, 2646-2649 Japan Water Works Association (JWWA) (2001) The method of Japan Water Works Association p.573-613 (in Japanese) Kobayashi, F., Hayata, Y., Kohara, K., Muto,...

Ngày tải lên: 05/09/2013, 09:38

10 451 1
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... tyrosine kinases participates in growth regulation of human breast carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, ... STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic activities, and they regulate each others activity Thus, the inhibition of both factors in vivo may have unpredictible ... which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR (mutated hairpin control ODN) (Sigma-Proligo; Sigma-Aldrich...

Ngày tải lên: 18/02/2014, 08:20

11 558 0
Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf

Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf

... bi-maxillary retruded profile representing the typical straight profile in Caucasian subjects Each image only had one manipulated dental or skeletal component Mexican female and male profiles are ... position of the lower jaw to a greater extent than the position of the upper jaw in cases of upper and lower jaw surgery Another obvious fact was that male profile with bimaxillary protrusion was not ... their respective lateral cephalometries were used to generate another manipulated images In these created images, hard tissue normal values were altered in at least two standard deviations Facial...

Ngày tải lên: 19/02/2014, 17:20

7 708 0
Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula officinalis pptx

Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula officinalis pptx

... 11(Z)- tetradecenoate to 10(E),12(E)-tetradecadienoate by initial H-abstraction at C10 and 11(E)-tetradecenoate to 9(Z),11(E)-tetradecadienoate by initial oxidative attack at C9 [39] Whether these ... mL) of the pYJ/DTY1 0a2 strain of S cerevisiae incubated at 20 °C for days to permit relatively rapid growth and then at 15 °C for a further days to reach saturation at a temperature which has been ... reaction has been determined to be at the carbon furthest from C-1 In contrast, all other desaturase-catalyzed oxidations studied to date are initiated at the carbon closest to the acyl headgroup...

Ngày tải lên: 08/03/2014, 09:20

6 341 0
Báo cáo khoa học: Differences in substrate specificities between cysteine protease CPB isoforms of Leishmania mexicana are mediated by a few amino acid changes potx

Báo cáo khoa học: Differences in substrate specificities between cysteine protease CPB isoforms of Leishmania mexicana are mediated by a few amino acid changes potx

... pGL40: 5¢-GACGCCGGTGA AGAATCAGGGTGCGTG-3¢, OL418 to generate pGL41: 5¢-CGAACGGGCACCTGTACACGGAGGACAGC-3¢ and OL420 to generate pGL42: 5¢-GCTGCGATGACA TGAACGATGGTTGCGACGGCGGGCTGATGC-3¢ These mutant constructs ... Dcpb by transfection allowed an investigation into the functional roles of these amino acids The activity of the enzyme expressed in the parasite was then analyzed towards gelatin and a small ... kDa The antiCPB serum recognized CPB isoenzymes that migrated as a major band with a molecular mass of 27 kDa and a minor band of molecular mass 26 kDa in cell lysates of stationary phase promastigotes...

Ngày tải lên: 23/03/2014, 13:20

11 543 0
photocatalytic  properties  of  hierarchical  zno  flowers  synthesized  by  a

photocatalytic properties of hierarchical zno flowers synthesized by a

... with a sharp tip The abundance of petals will greatly increase the contact area between the catalysts and organic dyes Moreover, the gap formed by the adjacent nanosheets would enhance the absorption ... of S0 and P0 were investigated by the degradation of MO dye under UV irradiation Fig compares the photodegradation of MO as a function of irradiation time for the P0 and S0 samples As clearly ... Results and discussion To investigate the appropriate calcinations temperature for the transformation of the precursor to ZnO, the thermal analysis in air atmosphere was conducted Typical TGA/DTA plots...

Ngày tải lên: 06/05/2014, 13:26

5 280 0
Báo cáo hóa học: "Fabrication of Densely Packed AlN Nanowires by a Chemical Conversion of Al2O3 Nanowires Based on Porous Anodic Alumina Film" potx

Báo cáo hóa học: "Fabrication of Densely Packed AlN Nanowires by a Chemical Conversion of Al2O3 Nanowires Based on Porous Anodic Alumina Film" potx

... for the preparation of densely packed AlN nanowires based on a new strategy In this strategy, the porous anodic alumina film on aluminum is etched into the alumina nanowires, and then the alumina ... 123 1128 Nanoscale Res Lett (2009) 4:1126–1129 involved with the supplement of the additional evaporated aluminum, and thus gives a larger diameter of the AlN nanowires than that of the Al2O3 ones ... phase of AlN (Ref: PDF card of No 25-1133) but a small quantity of a- Al2O3 phase This indicates that most of the alumina nanowires have been converted into the AlN nanowires during heat treatment...

Ngày tải lên: 21/06/2014, 20:20

4 269 0
Báo cáo y học: " HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector" ppt

Báo cáo y học: " HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector" ppt

... non-transduced and transduced cells Primers specific for CXCR4 (forward: 5'-ggaggggatcagtatatacacttc and reverse: 5'-cgccaacatagaccaccttttc) and CCR5 (forward: 5'-caaaaagaaggtcttcattacacc and reverse: ... phophatase (Promega, Madison, WI), was then added An alkaline phophatase substrate reagent, Western Blue (Promega), was used to visualize the bands RT-PCR Total RNA was extracted from non-transduced ... AIDS Research and Therapy 2005, 2:1 constraints with HAART therapy are the development of drug resistant viral mutants and toxicity after prolonged therapy Intracellular immunization by gene...

Ngày tải lên: 10/08/2014, 05:20

12 276 0
Báo cáo y học: "Open Access Perforation of Meckel''''s diverticulum caused by a chicken bone: a case report" doc

Báo cáo y học: "Open Access Perforation of Meckel''''s diverticulum caused by a chicken bone: a case report" doc

... general anaesthesia A normal appendix was identified during laparoscopic examination of the abdomen An inflammatory mass was seen with turbid fluid collection in the pelvic area on laparoscopy The ... congenital anomaly of the gastrointestinal tract, it is often difficult to diagnose A very small percentage of ingested foreign bodies can cause perforation of the bowel, leading to acute abdomen ... primary anastomosis of the adjacent small bowel A small piece of chicken bone was found within the Meckel's diverticulum The patient made an uneventful recovery postoperatively and was discharged...

Ngày tải lên: 11/08/2014, 19:21

2 304 0
Báo cáo y học: "NGAL: an emerging tool for predicting severity of AKI is easily detected by a clinical assay" potx

Báo cáo y học: "NGAL: an emerging tool for predicting severity of AKI is easily detected by a clinical assay" potx

... clinical settings [3] Most of the studies evaluating NGAL as a predictor of AKI used a research-based ELISA assay The availability of a standardized clinical platform for NGAL measurement would make ... Dial Transplant 2008, 23:3737-3743 Haase M, Bellomo R, Devarajan P, Schlattmann P, Haase-Fielitz A: Accuracy of neutrophil gelatinase-associated lipocalin (NGAL) in diagnosis and prognosis in acute ... differ at any time between those who did and did not develop AKI Page of Recommendation NGAL and other novel biomarkers such as cystatin C [7] can lead to rapid detection of AKI A strategy of early...

Ngày tải lên: 13/08/2014, 20:22

2 245 0
IN VIVO MECHANICAL AND PHYSIOLOGICAL CHARACTERISATION OF LOWER LIMB SOFT TISSUE BY a LOCAL INDENTATION TECHNIQUE

IN VIVO MECHANICAL AND PHYSIOLOGICAL CHARACTERISATION OF LOWER LIMB SOFT TISSUE BY a LOCAL INDENTATION TECHNIQUE

... correct placement at the prosthetic interface, as well as the related data acquisition and interpretation approach An ideal system should be able to continually gather data on both normal and shear ... identified on the FE model and a unit-normal compressive load was applied The soft tissue was assigned an initial E value and an analysis was carried out By comparing the FE analysis results with the experimental ... methods from the above equation at given values of the parameters a/ h and ν Tables of values of k over a range of a/ h and ν were provided by Hayes et al [51] for both plane-ended and spherical-ended...

Ngày tải lên: 09/10/2015, 11:24

143 593 0
w