the generation of pancreatic beta cells from stem cells intra and extrapancreatic sources mairi brittan naomi j guppy tariq g fellous and malcolm r alison
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
Ngày tải lên :
23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGTCTGCCCTGACTCAGCCTGC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC...
- 11
- 679
- 0
báo cáo hóa học:" New views on the hypothesis of respiratory cancer risk from soluble nickel exposure; and reconsideration of this risk''''s historical sources in nickel refineries" potx
Ngày tải lên :
20/06/2014, 00:20
... post-WWII KNR area sampling measurements through 1967 [F6: Glømme J: Arbeidshygieniske undersökelser over virkningen av irriterende gasser og forskjellige partikulæforurensingeer I arbeidsatmosfæren ... Andersen A: Cancer of respiratory organs among workers at a nickel refinery in Norway Int J Cancer 1973, 12:32-41 Magnus K, Andersen A, Høgetveit AC: Cancer of respiratory organs among workers ... for workers in the Electrolysis department compared with workers in Roasting and Smelting This was surprising and in contradiction with earlier reports and with the then prevailing view that the...
- 27
- 512
- 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
Ngày tải lên :
11/08/2014, 10:23
... pre-pulsing were used as controls The results are representative of two similar experiments and mature DC yield, thereby generating much higher numbers of DC per vessel A number of benefits arise ... culture level also requires additional manipulation and is not straightforward In contrast, the roller bottle system offers a simpler and more fool-proof method to generate the same or even greater ... normal donor leukopheresis product, accounting for the lower yield of mature DC the yield of mature DC in both systems and the percentage of mature DC relative to the original PBMC load On average,...
- 11
- 469
- 0
Generation of hepatocyte like cells from mouse embryonic stem (ES) and bone marrow (BM) cells
Ngày tải lên :
16/09/2015, 12:10
... and originates from endodermal germ layer The endoderm germ layer derives from the epiblast during gastrulation It differs from the visceral endoderm, which arises from a non-embryonic lineage ... CTT-3 and 5’ -GAT GGG CAG TGC TCA TTG TTT-3’ (iv) haptoglobin mRNA , (895 bp) 5’ -AAA CGA CGA GAA GCA ATG GGT-3 and 5’ -GAA GGC AGG CAG ATA GGC ATG-3’ (v) ApoE mRNA (451 bp) 5’ , -CTG AAC CGATTC TGG ... necessary prerequisite and in this regard, hepatic stem cells and/ or progenitor cells are ideal candidates Particular cell response to different liver injury The restitutive response of the liver...
- 123
- 307
- 0
Báo cáo khoa học: "THE GENERATION OF TERM DEFINITIONS FROM AN ON-LINE TECHNOLOGICA" pot
Ngày tải lên :
01/04/2014, 00:20
... Sandra Waites and Catherine Yarker for their valuable contribution towards the realisaticn of this system, and ~ colleagues Rod Johnson and Professor Juan Sager for their advice during the course ... more structure, and have undergone systematic investigation over the years figure Network file record stn~cture The FLAGS field apart, all integer fields are logical pointers to other records ... indexing language The existence of overlapping and even parallel indexing languages attests the inadequacy of Errs for representing generally accepted terminological relationships Other problems...
- 6
- 309
- 0
báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx
Ngày tải lên :
20/06/2014, 00:20
... R, Mora-Tiscareno A, Franco-Lira M, Henriquez-Roldan C, Barragan-Mejia G, Garrido-Garcia L, Camacho-Reyes L, Valencia-Salazar G, Paredes R, Romero L, Osnaya H, Villarreal-Calderon R, Torres-Jardon ... matter of great controversy Some researchers have argued that this damage could be related to the cationic charge on the PM2.5 particles arising from the content of transition metals such as Fe and ... Photomicrograph of respirable particles sampled at the CENICA site Numbers 1, and correspond to spheres; numbers 2, and correspond to clusters; and plates; number corresponds to the reticular form...
- 11
- 511
- 0
Carbon Dioxide Emissions from the Generation of Electric Power in the United States ppt
Ngày tải lên :
29/06/2014, 02:20
... ENERGY STAR program EIA’s Voluntary Reporting of Greenhouse Gases Program collects information from organizations that have undertaken carbon-reducing or carbon-sequestration projects Most of the ... Emissions from the Generation of Electric Power in the United States energy sources used for electricity generation result in varying output rates for CO2 emissions from region to region across the ... Reporting of Greenhouse Gases,” (long form) and EIA1605EZ, “Voluntary Reporting of Greenhouse Gases,” (short form), 1997 and 1998 data 18 The Voluntary Reporting of Greenhouse Gases Program is currently...
- 21
- 398
- 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
Ngày tải lên :
09/08/2014, 10:22
... Acknowledgements The authors are grateful to Professor Andrew H Kang for providing the CII This work was supported by a grant (R1 1-2002-098-01001-0) from the Korea Science and Engineering Foundation ... or ankle, = slight edema and erythema from the ankle to the tarsal bone, = moderate edema and erythema from the ankle to the tarsal bone, and = edema and erythema from the ankle to the entire ... regulation involving regulatory T cells, including transforming growth factor beta (TGFβ)-producing T helper cells, IL-10-producing T regulatory cells, and CD4+CD25+ T cells [1,10,11] Previous studies...
- 10
- 473
- 0
Báo cáo y học: "Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions" pdf
Ngày tải lên :
10/08/2014, 05:21
... in CMCM group Furthermore, a voltage dependent inward current (Figure 4B) and a voltage dependent outward current (transient outward like current) (Figure 4C) can be recorded from the cells that ... J- L shows the fluorescent immunostaining of MHC of cells from these groups after and 10 days’ culturing Cells from CMCM and CMCM+S1P groups show strong expression of both a-actinin and MHC proteins, ... stored in a refrigerator for use Both FTIR and NMR studies confirmed the structure and composition of the copolymer Synthesis of thermo-responsive copolymer, film coating and characterization Chemicals...
- 9
- 262
- 0
Báo cáo y học: " Generation of H9 T-cells stably expressing a membrane-bound form of the cytoplasmic tail of the " pps
Ngày tải lên :
13/08/2014, 09:21
... Wolfram Hildebrandt for participation in the generation of the stably transduced H9 cells and Matthias T Dittmar for discussion The following reagent was obtained through the AIDS Research and Reference ... pNL-Tr712 virus also does not occur despite the presence of the EnvCT region anchored at the cellular membrane by its homologous TMD In order to generate virions for further analyses, the respective ... populations After removing input virus and thorough washing, the course of the infections was monitored by determining, via CA-ELISA, the amounts of released virions in the respective culture supernatants...
- 5
- 362
- 0
PERIPHERAL BLOOD a SIMPLE CELL SOURCE FOR THE GENERATION OF ANGIOGENIC PROGENITORS FROM MONOCYTES
Ngày tải lên :
09/09/2015, 10:13
... independent recruitment of PDGFR-β expressing cells to larger vessels Therefore it was proposed that PDGF-B secreted by migrating cells induces the proliferation and co-migration of pericytes from existing ... co-expressed haematopoietic progenitor marker CD34 and Sca-1 through various stages of angiogenesis Intrigued by this finding they further examined the matrigel plug sections for macrophage marker ... already in early stages of the embryo (Nucera et al 2011) First macrophages, which are found in the yolk sac of the embryo, are of maternal origin Later macrophages are of embryonic origin Embryonic...
- 124
- 509
- 0
Tài liệu Báo cáo khoa học: "Reactive Content Selection in the Generation of Real-time Soccer Commentary" pdf
Ngày tải lên :
20/02/2014, 18:20
... systems(Noda and Matsubara, 1996) The Soccer Server provides a real-time game log1 of a very high quality, sending information on the positions of the players and the ball to a monitoring program every ... Categories and examples of inference rules MIKE'S architecture - - a role-sharing multi-agent system is shown in Figure Here, the ovals represent concurrently running modules and the rectangles represent ... from RoboCup'97 For comparison, we have included MIKE'S French and Japanese descriptions of the same game period in Figure and Figure In general, the generated commentary differs because of the...
- 7
- 488
- 0
Tài liệu Báo cáo Y học: Targeting of malate synthase 1 to the peroxisomes of Saccharomyces cerevisiae cells depends on growth on oleic acid medium pptx
Ngày tải lên :
22/02/2014, 04:20
... 5¢-CACTGATTTGTGAGAATTCTGATCTCC-3¢ 5¢-CAATGAACTCTAGAGC-3¢ 5¢-GATACTAAGTGAGCTTAAGGAGG-3¢ 5¢-CCCGACGCCGGACGAGCCCGC-3¢ 5¢-AGAAAGATCTATCTAGTGGGTTGAATTGCGGACGTTGG-3¢ 5¢-AGAAGCATGCGATCACAATTTGCTCAAATCAGTGGGCGTCGCC-3¢ ... consisted of the promoter and terminator regions of MLS1 delineating the Ó FEBS 2002 open reading frame, with or without the codons for SKL, and URA3 (Scheme 2) Integration of the disruption fragments ... (lanes and 4) was absent from the corresponding organellar pellet (lane 6) These results con®rmed the requirement of SKL for peroxisomal import, and reiterated that the compartmentalization of malate...
- 8
- 444
- 0
Human Capital and the Development of Financial Institutions: Evidence from Thailand docx
Ngày tải lên :
06/03/2014, 10:20
... future borrowing depends on the other members of the group repaying their loans Each group member co-signs the loans of the others The formal agricultural lenders include the BAAC and various Agricultural ... eastern seaboard The other two provinces, Buriram and Sisaket are much further from Bangkok and are located in the relatively poor northeastern region Sisaket is one of the poorest provinces in the ... insignificant in the estimates for the Central region In the Central region, the percentage of survey households in the village who are currently customers of a formal sector agricultural lender...
- 38
- 515
- 0
Báo cáo khoa học: "AN APPLICATION OF AUTOfIATED LANGUAGE UNDERSTANDI;IG TECHNIQUES TO THE GENERATION OF DATA BASE ELEMENTS" potx
Ngày tải lên :
08/03/2014, 18:20
... approach to natural language understanding is written in FORTH, Pro]og, and SrIOBOL4, and runs on a PDP l]/45 under the RSX operating system The body of the "construct" clause consists of three ... mitigated somewhatby moving the working data to a form of virtual memorywhich is supported by FORTH, and by overlaying the grammarcode with the interpretation code THE UNDERSTANDING P O E S R CS ... E S R CS The formal definition of the sublanguage currently takes the form of an ATN grammar The parser takes a sentence as input and produces a parse tree The parse is input to the ERL "machine",...
- 4
- 391
- 0
"The Potential of Cellulosic Ethanol Production from Municipal Solid Waste: A Technical and Economic Evaluation" doc
Ngày tải lên :
09/03/2014, 00:20
... authors and not necessarily those of the Regents of the University of California, the University of California Energy Institute or the sponsors of the research Readers with further interest in or ... Brian Forsberg for their assistance in some experiments We are also grateful to Drs Hua-jiang Huang and Shri Ramaswamy from the University of Minnesota for their help in some Aspen modeling, and ... view of their transformation into ethanol Belgian Journal of Food Chemistry and Biotechnology 41(2):31-42 13 Grace TS, Barrett MD, Bilodeau VL, McCarty GL, Greenwood BF, Prough JR, Torregrossa...
- 41
- 554
- 0
Effect of Fund Size on the Performance of Mutual Funds Evidence from Iran pdf
Ngày tải lên :
16/03/2014, 17:20
... ER ER where Rj = average return for portfolio j during the specified time period; Rb = the average return for the benchmark portfolio during the period and σER = standard deviation of the excess ... 3-2-2 Treynor Ratio Treynor measure was developed by Jack Treynor The Treynor measure is similar to the Sharpe ratio measures risk adjusted performance of fund over per unit of systematic risk The ... funds from 19 countries The major finding of the study explained that size of the funds did matter and the performance of large funds was better Furthermore, young funds investing abroad performed...
- 14
- 664
- 0
Báo cáo khoa học: "Conceptual Coherence in the Generation of Referring Expressions" potx
Ngày tải lên :
17/03/2014, 04:20
... piece of scenery, since the word river might cause the hearer to focus on the aquatic reading of the word anyway A Gatt and K van Deemter 2005 Semantic similarity and the generation of referring ... picture norms 257 similar properties were used together with other properties (e .g the prince and the bachelor duke); if a superordinate term was used to replace the similar properties (e .g the ... editors, Words, Proofs, and Diagrams CSLI, Stanford, Ca C Barry, C M Morrison, and A W Ellis 1997 Naming the snodgrass and vanderwart pictures Quarterly Journal of Experimental Psychology, 50A(3):560–585...
- 8
- 414
- 0
Báo cáo khoa học: "CONSTRAINTS ON THE GENERATION OF ADJUNCT CLAUSES" potx
Ngày tải lên :
24/03/2014, 02:20
... determining the gapping pattern in the adjunct clause and retaining generality Derr & McKeown (1984) directly address the generation of complex sentences; however, they restrict the criteria for ... their thematic roles): Gap the first argument in the PC which is an occurrence of the matrix Theme a If the PC subject matches the matrix Goal, gap it; or b if there is no matrix Goal and the ... surface ordering of the arguments are made in the mapping to the next level of representation, the surface structure As this structure is traversed, decisions about the particular realization of the...
- 8
- 372
- 0
Internet Banking and the question of Bank Run: lesson from the Northern Rock Bank case pdf
Ngày tải lên :
29/03/2014, 09:20
... competitors NRB opted for a very aggressive lending strategy In 2006 there was an increase of 33% in gross lending, mainly residential mortgages accounting of which 40% represented remortgaging In ... money markets froze with the first signs of the crisis, the only alternative left to those banks was to borrow from the Bank of England Surprisingly the first reaction of the Bank of England has ... depositors trying as soon as possible to transfer their deposits to another bank The following day, long queues at the different Northern Rock Bank branches formed, the length of the queue being aggravated...
- 7
- 541
- 0