the foundation of c the c subset
Stringing in the Key of C#
Ngày tải lên :
04/10/2013, 21:20
... they were arrays of characters using either the foreach control or the index operator [] The following StringToCharAccess program demonstrates this technique: // StringToCharAccess - access the ... and continuing to the end of the string: “cd,e” (It’s the “+ 1” that skips the comma.) The Concat() function puts the two substrings back together to create “abcd,e” Control passes back up to the ... effect of removing the character(s) The logic is much simpler and less error-prone The foreach loop in the second half of the program puts the pieces back together again The output from the program...
- 24
- 466
- 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc
Ngày tải lên :
19/02/2014, 07:20
... GAT CCG TGG GCC GCA-3¢ 5¢-GAA TGA CTC GAG CCG AAG TAA TC-3¢ 5¢-CTT CTG AGG ATC CCA AAT GAC AGT-3¢ 5¢-CAT GTA AGC CCC CTC GAG TCG TTC AG-3¢ 5¢-CGT CAC GGT ATT CGA AGC C- 3¢ 5¢-CAC TGG CTA ATT CCA ... AGC C- 3¢ 5¢-CAC TGG CTA ATT CCA GTG C- 3¢ 5¢-CAC TAG CGA AGA TGC CGT C- 3¢ 5¢-CCA ACG CAG AAA CTC GGC-3¢ 5¢-CGG CAT TAT CGG TGA CAG C- 3¢ 5¢-CGC GCA ACA CTG AGG GAC-3¢ Forward Reverse Forward Reverse ... semialdehyde is then converted to succinate by the SsaDH encoded by the sad gene of pAO1 (see Fig 2) Succinate may enter the citric acid cycle, thus completing the catabolic pathway of CH3-4-aminobutyrate...
- 9
- 524
- 0
Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx
Ngày tải lên :
07/03/2014, 09:20
... in the V2 contribution of the spectral component S2 Actually, the temperature profile of the V2 contribution is in accordance with the reduction in the bent population in the oligonucleotide Thereby, ... Fluorescence emission spectrum of fluorescein (—) Fluorescence emission spectrum of fluorescein conjugated to SREfos (e) Both spectra are normalized The fluorescence emission spectra of fluorescein conjugated ... dynamics in the speci c attachment of core-SRF to SREfos Results Electric charge distribution in SRE containing oligonucleotides at 10 C The electric charge distribution along the phosphate backbone...
- 16
- 538
- 0
Báo cáo khoa học: Interaction of an 40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf
Ngày tải lên :
16/03/2014, 18:20
... to their speci c recognition site with higher affinity [40], these factors could form a complex even in the presence of several thousand-fold excess of nonspeci c DNA (Fig 1C) The optimum concentration ... in the presence of 7.5% of formamide (C) RLjunRP can form complexes even in the presence of a 40 000-fold excess of fragmented calf thymus DNA The binding reactions were carried out with ng of ... optimum concentration of MgCl2 required for the complex formation was titrated by carrying out EMSA in the presence of different concentrations of MgCl2 (Fig 1E) Complex formation could be seen in the...
- 11
- 438
- 0
Báo cáo khoa học: Non-hydrolytic functions of acetylcholinesterase The significance of C-terminal peptides pptx
Ngày tải lên :
23/03/2014, 07:20
... In cultures of glial cells, oxidative stress of the type thought to occur as the final common path in neurodegeneration, increases the influx of calcium through L-type calcium channels [16] which, ... further cell death, the symptoms would never appear – an effective ‘cure’ Such a prospect remains, of course, purely speculative; but the more we can characterize non-hydrolytic functions of acetylcholinesterase ... circle) Lineweaver–Burk plot for the reciprocal of the rate of reaction (1 ⁄ reaction rate) versus the reciprocal of substrate (acetylthiocholine) concentration (1 ⁄ [ATC]) By observation, substrate...
- 8
- 316
- 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
Ngày tải lên :
23/03/2014, 20:22
... p123jun-eGFP consists of the )123 to +53 region of c- jun cloned upstream of the GFP coding region and p148jun-eGFP consists of the )148 to +53 region of c- jun cloned upstream of the GFP coding region ... diploid cells Sequence-speci c binding of RLjunRP Specificity of the complex formation between the factors and the )148 to )124 region of c- jun was examined (Fig 3B) by preincubating 100 lg of the ... 200-fold excess of nonspeci c DNA was used for competition, indicating the specificity of complex formation The complex formation did not take place in the Ó FEBS 2003 Regulation of c- jun expression...
- 9
- 449
- 0
Báo cáo khoa học: Annexin A2 binds to the localization signal in the 3¢ untranslated region of c-myc mRNA ppt
Ngày tải lên :
30/03/2014, 15:20
... speci c mRNAs such as c- myc [9,17,19] The observation that the 36 kDa protein which binds to the localization signal in c- myc 3¢UTR is recovered in such a cytoskeletal fraction but not in the cytosolic ... cDNA containing exons + of the mouse c- myc gene in pBluescript SK A 362 bp fragment encoding the 3¢UTR of mouse c- myc mRNA was synthesized by PCR from pBluescript containing the complete genomic ... describe the speci c binding of a trans-acting factor to the region of the 3¢UTR of c- myc mRNA previously shown to contain the localization element, and identify this protein as annexin A2 The...
- 9
- 232
- 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
Ngày tải lên :
31/03/2014, 09:20
... it can be concluded that the hydrophobic face of D16W-D24)37 GGN4 is in close contact with the hydrophobic core of the SDS micelles, at least through the residues F9, V13, and W16 All of the ... in the case of tryptamine, more efficiently or more tightly than NATA Thus, the structure and/or the physico-chemical property of the peptide seems to contribute to the effective anchoring of the ... SDS micelles, which have negatively charged surfaces, mimic the bacterial cell membrane with its negatively charged surface, while DPC micelles, which have zwitterionic surfaces, mimic the eukaryotic...
- 8
- 447
- 0
the elements of c++ style
Ngày tải lên :
03/06/2014, 00:57
... each type of software element Specify the order in which the descriptions of these characteristics should appear within the documentation block Indicate which descriptions are required and which ... place the brace at the end of the line that controls entry into the block, or you may place it on the next line and align it with the first character of the first line You should always place the ... minimize the impact of future changes TEAM LinG 36 THE ELEMENTS OF C+ + STYLE 48 Use the Active Voice to Describe Actors and Passive Voice to Describe Actions In English prose, the active voice is...
- 191
- 458
- 0
d. of c 219. You should get into the habit of ……………… at least one newspaper daily. a. pot
Ngày tải lên :
18/06/2014, 17:20
... been acclaimed by colleagues as ………… of all modern architects a the greater b the greatest c the more great d the most great b II FIND THE MISTAKES (400 SENTENCES ) The main office of the factory ... a they are going to b they are will c they would d they shall c 337 The car was easy to recognize, …………… it wasn’t difficult for the police to catch the thieves a because b that c so d but c ... …………… to call his new company “Office-Fit” and was already very successful a had decided b was deciding c decided d has decided a 319 They hope that their plan will be a …………… a succeed b successful...
- 28
- 416
- 0
Báo cáo hóa học: " Research Article On the Fixed-Point Property of Unital Uniformly Closed Subalgebras of C X" docx
Ngày tải lên :
21/06/2014, 07:20
... denote by C X, τ the set of all f ∈ C X for which f ◦ τ f Then C X, τ is a unital uniformly closed real subalgebra of C X which separates the points of X, does not contain the constant function i ... unital commutative real Banach algebra A complex character on A is a nonzero homomorphism ϕ : A → C, regarded as a real algebra The set of all complex character on A is called the carrier space of ... Proof i is obvious To prove ii , let ϕ ∈ Ω C X, τ Then ϕ ∈ Car C X, τ and so there exists x ∈ X such that ϕ ex , where ex is the complex character on C X, τ at x Since ϕ C X, τ ⊆ R, we conclude...
- 9
- 363
- 0
Báo cáo khoa học: "Increased phosphorylation of c-Jun NH (2)-terminal protein kinase in the sciatic nerves of Lewis rats with experimental autoimmune neuritis" ppt
Ngày tải lên :
07/08/2014, 18:21
... ni nwohs saw NAE fo esruoc lacinilc ehT NAE fo noitavresbo lacinilC stluseR )napaJ ,supmylO( epocsorcim lacofnoc resal 005VF na htiw denimaxe erew snemiceps deniats -ecnecseroulfonummi elbuod ehT ... sllec yrotammalfni mµ 03 = srab elacs eht ,C- A nI sevren citaics eht ni )neerg( sllec nnawhcS evitisop 001S ni dezilacol-oc ton erew )der( noitcaer-LENUT emoS )C( )sworra( wolley gniwohs sroloc ... sevren citaics eht ni KNJ-p rof epytonehp llec eht ezilausiv ot deilppa saw sisylana lacimehcotsihonummI sevren citaics tar detceffa-NAE ni KNJ-p fo noitazilacoL )1 giF( )5 = n( star lortnoc lamron...
- 5
- 206
- 0
Báo cáo lâm nghiệp: "The effects of lifting on mobilisation and new assimilation of C and N during regrowth of transplanted Corsican pine seedlings. A dual 13C and 15N labelling approach" docx
Ngày tải lên :
08/08/2014, 01:22
... [23] Total content of C (Qc) comprised old C (Qc, old, incorporated before day 0) and new C (Qc, new, incorporated after day 0) contents [4]: Qc = Qc, old + Qc, new where Qc, old = Xc × Qc with at ... with the exception of new roots limit negative effects of decreased water and N entry, through decreased stomatal conductance and increased allocation of N As a consequence, C assimilation, carbohydrate ... metabolic processes The photosynthetic activity in plants is generally strongly correlated with their N concentration even if the relationship between N concentration and CO2 assimilation capacity...
- 11
- 399
- 0
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx
Ngày tải lên :
09/08/2014, 01:22
... (forward) and CTCGCCGTTTCCTCAGTAAG (reverse) For p15 the primers used were CAGAGCTGTTGCTCCTCCAC (forward) and CGTGCAGATACCTCGCAATA (reverse) For p21 the primers used were AGCAAAGTATGCCGTCGTCT (forward) ... (forward) and ACACGCTCCCAGACGTAGTT (reverse) For p27 the primers used were ATAATCGCCACAGGGAGTTG (forward) and CCAGAGTTTTGCCCAGTGTT (reverse) For -actin, the primers were AGCCATGTACGTAGCCATCC (forward) ... PD98059 decreased cMyc production in cultured ocular choroidal melanoma which had a high and constant level of c- Myc Also, the contribution of Ras/Raf/ERK prevented the rapid degradation of c- Myc by...
- 12
- 535
- 0
báo cáo khoa học: "Gastrointestinal Stromal Tumours treated before and after the advent of c-kit immunostaining" pptx
Ngày tải lên :
09/08/2014, 01:24
... prognostic factor for sarcomatosis Cancer 2002, 94:2441-2446 Chan JKC: Mesenchymal tumours of the gastrointestinal tract: a paradise for acronyms (GUMP, GIST, GANT, and now GIPACT) Implications of c- kit ... identified complete resection and sex as the most important positive prognostic factors, and the presence of separate malignancy as the most important negative prognostic factor for survival Of the ... R, Cirilli C, Rashid I, Marcheselli L, Luppi G, Federico M: Incidence and clinicopathologic features of gastrointestinal stromal tumors A population-based study BMC Cancer 2007, 7:230 Pidhorecky...
- 4
- 320
- 0
Báo cáo y học: "Proteinase-3 as the major autoantigen of c-ANCA is strongly expressed in lung tissue of patients with Wegener’s granulomatosis" pptx
Ngày tải lên :
09/08/2014, 03:24
... as B cells, T cells, granulocytes and macrophages helped in the characterization of these cells We detected B cells in some secondary lymphoid follicles and a few scattered in the tissue T cells ... +101 of the cDNA); and PR-3 ‘antisense’, 5′-GCGGCCAGGGAACGAAAGTGCA (at the end of exon 4, corresponding to bases +553 to +582) The expected size of the fragment was 500 base pairs The cDNA fragment ... with light and fluorescent microscopy The lectin of B purpurea binds specifically to pneumocytes type I, whereas the lectin of M pomifera binds to pneumocytes type II Microscopic evaluation and semiquantitative...
- 7
- 370
- 0
Báo cáo y học: "Usefulness of C-reactive protein in monitoring the severe community-acquired pneumonia clinical course" ppsx
Ngày tải lên :
13/08/2014, 08:20
... for the CRP ratio, the body temperature and the WCC on day of antimicrobial therapy The indicative accuracy of these variables at day was assessed by calculation of the area under the curve (AUC), ... (SOFA) score [10,11] and the PaO2/FiO2 ratio were recorded daily After clinical CAP diagnosis, all patients received empirical antibiotic therapy according to the American Thoracic Society CAP ... by day the CRP ratio had decreased by almost 50% from the admission concentration Comparisons of receiveroperating characteristic curves showed that the prognostic performance of the CRP ratio...
- 9
- 241
- 0
Crossculture in international business negotiation the case study of C food international group in Vietnam
Ngày tải lên :
25/11/2014, 00:40
... aspect, CFood is monochronic and its partners are polychronic It is the polychronic characteristic of the Vietnamese suppliers that are heavily affecting the efficiency of the C- Food’s supply chain ... special circumstance Negotiators of this group focus only on the convenience They not pay much attention to comparing the cost, price, and quality of the goods or service They belong to the so-called ... resume the production On the other hand, it has to deal with the consequences of the delay caused by the supplier Value of time: monochronic vs polychronic A culture is monochronic if it respects...
- 63
- 1.1K
- 1
Modeling the chemotaxis behaviors of c elegans using neural network from artificial to biological approach
Ngày tải lên :
10/09/2015, 09:12
... rate C Food or toxin concentration Cmax Maximum concentration of food or toxin Cmax,f Maximum concentration of food Cf Concentration of food Ctx Concentration of toxin Clef t Concentration of food ... avoidance The x-axis depicts the toxin concentration difference between two consecutive time instances, C( t) = C( t) − C( t − 1) The y-axis presents the output of the motor neurons according to C( t) ... Parameter of activation function for neuron i δi Decide whether there exists the outside input to neuron i VC1 Voltage of CPG neuron C1 VC2 Voltage of CPG neuron C2 VC3 Voltage of CPG neuron C3 VC4...
- 243
- 242
- 0