the example of the history of a city

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Measuring the Economic Value of a City Park System docx

Measuring the Economic Value of a City Park System docx

... university quadrangles, and corporate campuses.) Third, the amount and characteristics of rainfall are calculated from U.S weather data The model (which Philadelphia Department of Parks and Recreation ... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate ... flowing around them Beyond the famous Japanese cherry trees around the Tidal Basin, the stately elms gracing the Reflecting Pool, and massive oaks of Lafayette Park, there are 4,839 acres of general...

Ngày tải lên: 02/04/2014, 08:20

28 386 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

... diffusion and basically changing the awareness of the target audience Normally, these activities are of importance in the academic environment, and are indicated by the publication of articles in ... presentations at conferences) are criteria which are valued in the assessment of academic staff members, whereas the other criteria are of no value In all types of research, the researchers stated that ... designed and conducted the study SN, MG, MS, and MA gathered the data KM assisted in interpreting the statistical analysis and manuscript writing All authors approved the final manuscript Additional...

Ngày tải lên: 11/08/2014, 05:21

8 341 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

... diffusion and basically changing the awareness of the target audience Normally, these activities are of importance in the academic environment, and are indicated by the publication of articles in ... presentations at conferences) are criteria which are valued in the assessment of academic staff members, whereas the other criteria are of no value In all types of research, the researchers stated that ... designed and conducted the study SN, MG, MS, and MA gathered the data KM assisted in interpreting the statistical analysis and manuscript writing All authors approved the final manuscript Additional...

Ngày tải lên: 11/08/2014, 16:21

8 315 0
 a first example of a lyotropic smectic c analog phase

a first example of a lyotropic smectic c analog phase

... solely upon the addition of a solvent are considered to be real lyotropic analogs of the SmC phase in the following The phase diagram of an often cited example of a lyotropic SmC analog phase reported ... direction of the layer normal k, b the lamellar Lα phase with indicated directions of the layer normal k and the director n, c the SmA phase and d the SmC phase in which the layer normal k and the ... surfactants and the solvents shall be elucidated • Measurement of the phase diagrams of the selected surfactant/solvent systems using polarized optical microscopy and characterization of all phases...

Ngày tải lên: 17/06/2017, 08:14

130 333 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...

Ngày tải lên: 21/09/2012, 10:39

386 1,2K 4
A View of the History of Biochemical Engineering

A View of the History of Biochemical Engineering

... Valley Authority (Farina 1991) and the U.S National Renewable Energy Laboratory (Wyman 1991) Recent work by ARKENOL in California, USA (Cuzen 1997) and APACE in New South Wales, Australia, have ... was organized by researchers of the Oak Ridge National Laboratory, Oak Ridge, Tennessee, under the leadership of Dr Charles D Scott Later, researchers of the National Renewable Energy Laboratory, ... Katzen · G.T Tsao launched as a way of increasing the production capacity of penicillin, used to cure battle wounds of World War II (Shuler and Kargi 1992) Fungal mycelia grow naturally on the...

Ngày tải lên: 23/10/2013, 17:20

15 583 0
Tài liệu Republican Legal Theory The History, Constitution and Purposes of Law in a Free State ppt

Tài liệu Republican Legal Theory The History, Constitution and Purposes of Law in a Free State ppt

... Oxford Journal of Legal Studies (1991); Chapter as “Republican authority” in Canadian Journal of Law and Jurisprudence (1992); Chapter as The actual validity of law” in 37 American Journal of Jurisprudence ... servitude as a violation of natural law American republicans never feared commerce or wealth as the Spartans had, and the new American “Republican” party sought to maximize both, by reinvigorating the ... of the Palgrave Macmillan division of St Martin’s Press, LLC and of Palgrave Macmillan Ltd Macmillan® is a registered trademark in the United States, United Kingdom and other countries Palgrave...

Ngày tải lên: 18/02/2014, 11:20

211 750 1
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

... accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢ The incorporation of mutations was verified by DNA ... E19 0A, 5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E19 4A, 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; ... Journal compilation ª 2008 FEBS L M F Mendonca and S R Marana ¸ Following the characterization of the binding of different types of aglycone, a comparative analysis of the mutational effect on their...

Ngày tải lên: 18/02/2014, 17:20

12 732 0
A Text-Book of the History of Architecture Seventh Edition, revised pdf

A Text-Book of the History of Architecture Seventh Edition, revised pdf

... the arrangement of the points of support, and hence the nature of the structural design A comparison, for example, of the plans of the Hypostyle Hall at Karnak (Fig 11, h) and of the Basilica ... the North and West, meanwhile, under the growing institutions of the papacy and of the monastic orders and the emergence of a feudal civilization out of the chaos of the Dark Ages, the constant ... Jugganat the name of the deity is Jagannath; the English name-form led to the word “juggernaut” Kantonnuggur Kantanagar the author seems not to have realized that this is the same place as Oudeypore...

Ngày tải lên: 05/03/2014, 14:20

25 500 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

... II of maltase is the catalytic nucleophile Because the Asp214 of maltase is equivalent to the Asp215 of isomaltase, a mutant with the residue altered to Ala was tested for its activity on a- pNPG ... YGR287c The sequence data for isomaltase is available from the DNA Data Bank of Japan with accession number AB109221 The entire coding region of the insert was amplified by PCR and subcloned into the ... Mun/Bpu and Mun/Bst were about 10 and 80 times lower than that of isomaltase, respectively The Km for a- pNPG of Mun/Bpu was the same as that of isomaltase, whereas the Km for a- pNPG of Mun/Bst was about...

Ngày tải lên: 07/03/2014, 16:20

7 452 0
Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot

Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot

... by almost all the papal sovereigns of Europe A remarkable circumstance is related of the hopes and intentions of the Spaniards, in the event of success in the Armada A Spanish officer, who was ... gentleman At this stage of the examination, the lord chamberlain saw a man standing in a corner of the cellar, who stated that he was Percy's servant, and that he was left by his master in charge of ... merely to an attempt, on the part of the Romanists, at the commencement of the session, to obtain a toleration for their worship, and the relaxation of some of the penal laws Various attempts have...

Ngày tải lên: 08/03/2014, 22:20

74 422 0
The History of a Mouthful docx

The History of a Mouthful docx

... closed at each end; at the upper one by the last ring of the _aesophagus_, and at the lower by another ring of the same kind, only stronger; the watchful guardian of the passage which leads to the ... the case of a mouthful of bread and meat swallowed at once, the bread passes away on its travels long before the meat has done dancing attendance in the stomach, awaiting that transformation ... more than a whole plateful of salad Meat is a stone absolutely full of gold, while the salad has only a few veins of it here and there, and by far the greater part of the material it sends to the...

Ngày tải lên: 08/03/2014, 22:20

153 473 0
Hygeia, a City of Health, by Benjamin Ward Richardson This eBook give it away or re-use it under the terms of the Project Gutenb doc

Hygeia, a City of Health, by Benjamin Ward Richardson This eBook give it away or re-use it under the terms of the Project Gutenb doc

... the limbs of the natives of Van Diemen's Land and New Holland was as 50 degrees of power, while that of the Frenchmen was 69, and of the Englishmen 71 The same order of facts are maintained in ... The substratum of the city is of two kinds At its northern and highest part, there is clay; at its southern and southeastern, gravel Whatever disadvantages might spring in other places from a ... several houses They are surrounded with garden space, and add not only to the beauty but to the healthiness of the city The large houses of the wealthy are situated in a similar manner The streets...

Ngày tải lên: 15/03/2014, 15:20

116 377 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... present any activity on thiamin degradation Other enzymes involved in the thiamin pathway A comparative analysis of the thiamin biosynthetic pathway of more than 80 bacterial genomes was performed ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully...

Ngày tải lên: 16/03/2014, 00:20

9 491 0
Black: The History of a Color

Black: The History of a Color

... beginning and that the universe is eternal and infinite, a primal image of a world made of darkness asserts itself nonetheless—that is to say, a world made of a material that absorbs all the electromagnetic ... B.C., National Archaeological Museum, Athens 22 BLACK_THIRD_PASS 7/11/08 8:58 AM Page 24 umans have always been afraid of the dark They are not nocturnal animals, they never have been, and even ... realm of Erebus, son of Chaos and brother of Night All insist on the color black for the dwelling place of the dead 33 The Bear, a Wild Animal For the Romans, the bear was the strongest of all animals...

Ngày tải lên: 16/03/2014, 18:12

216 450 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

... sequence was 5¢-GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3¢, with GAC, CAA and TCA as mutated codons for E451D, E451Q and E451S, respectively DNA sequencing was used to confirm the incorporation ... affected by the exchange of a charged participant (carboxyl group of the E side-chain) for an uncharged participant (amide group of the Q side-chain) Otherwise, the replacement of E451 with D and S ... ÔeÕ stands for an equatorial hydroxyl and a for an axial one Therefore, the interaction between any residue at position 39 and an equatorial 4-OH was called /4e, and between any residue at position...

Ngày tải lên: 16/03/2014, 18:20

9 371 0
Confronting Images: Questioning the Ends of a Certain History of Art

Confronting Images: Questioning the Ends of a Certain History of Art

... approximation to renounce the humanism of the history of art: death Resemblance as drama Two medieval treatises facing Vasari: the rent subject facing the man of humanism The history of art is a history ... of Vasarian academicism: triumphant ri` nascita recast in a certain notion of the history of art as rationalist humanism; the famous imitazione recast in a hierarchical table of the relations between ... mousetraps in the Merode Altarpiece.2 Thanks to Panofsky, we are aware that the very transparence of a window, in the context of an Annunciation, can serve as a vehicle for the most resistant of theological...

Ngày tải lên: 18/03/2014, 09:15

337 427 0
THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt

THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt

... illustrations of the general nature of a candle that I can possibly give The fuel provided, the means of bringing that fuel to the place of chemical action, the regular and gradual supply of air ... sulphuric acid, which takes away the lime, and leaves the fat re-arranged as stearic acid, whilst a quantity of glycerin is produced at the same time Glycerin absolutely a sugar, or a substance similar ... from Japan, since we have forced an entrance into that out -of -the- way place a sort of wax which a kind friend has sent me, and which forms a new material for the manufacture of candles And how are...

Ngày tải lên: 22/03/2014, 14:20

164 271 0
THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf

THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf

... PHILADELPHIA In 1789, he became assistant secretary of the Treasury THE LIBRARY COMPANY OF PHILADELPHIA 1800, Adams left Philadelphia for the new capital city, the College of New Jersey (later Albert ... Historical and Architectural Data,” Philadelphia: Independence National Historical Park, April 1981 The First Bank of the United States 11 rates and thus bank profits Without the restraining hand of ... commerce and often tattered, militia of industry, repaying war debt, restoring the value of the the American colonies had currency, and lowering inflation defeated the army of one of the greatest nations...

Ngày tải lên: 22/03/2014, 21:20

20 695 0
w