the entity relationship model of a database

... track of the start date of the department manager – Each department controls a number of PROJECTs Each project has a name, number and is located at a single location Example COMPANY Database (Cont.) ... FUNCTIONALITY Embarcadero Technologies ER Studio Database Modeling in ER and IDEF1X DB Artisan Database administration and space and security management Oracle Developer 2000 and Designer 2000 Database ... Weak Entity Types Roles and Attributes in Relationship Types  ER Diagrams - Notation  ER Diagram for COMPANY Schema  Alternative Notations – UML class diagrams, others Example COMPANY Database...

Ngày tải lên: 12/05/2014, 11:55

... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database. In Proceedings of the International Conference ... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... optimization abilities that will translatea languageexpressioninto a query evaluationplan in someevaluation algebra Query Evaluation: If a query language is specified, the EADT must provide the ability...

Ngày tải lên: 16/03/2014, 16:20

... quantitatively measured in the of the host The size 2of the bone formationlateral view bone was also The size of the bone formation of the host bone was also quantitatively measured in the lateral ... in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that in the (MC-; FGF2-) group at weeks in ratio Bone incorporation, ... phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin...

Ngày tải lên: 20/06/2014, 04:20

... để mô tả CSDL d a tập hợp phép toán Các mô hình CSDL phổ biến:          Mô hình phân lớp (hierarchical model) Mô hình mạng (network model) Mô hình quan hệ (relational model) Mô hình thực ... thể-liên kết (entity- relationship model) Mô hình hướng đối tượng (object model) Mô hình XML – bán cấu trúc (semi-structural model) EE4509, EE6133 – HK2 2011/2012 TS Đào Trung Kiên – ĐH Bách khoa Hà Nội ... khoa Hà Nội Đặc điểm mô hình ER   Mô hình ER cho toán, mà mang tính chủ quan người thiết kế Các l a chọn thay được:     20 Thực thể  thuộc tính Thực thể  liên kết Liên kết hai  ba hay...

Ngày tải lên: 28/06/2014, 05:20

... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... modeled The simulator runs until all clean segments are exhausted, then simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator...

Ngày tải lên: 12/09/2012, 15:05

... Al-Abbasi M .A. , Al-Karaghouli A. A., Minasian A. N Photochemically assisted solar desalination of saline water Desalination 1992, 86(3), 317–324 [4] Mowla D, Karimi G Mathematical modeling of solar still ... is refined latent heat of vaporization of water at the condenser surface of last stage (J/kg), h fgNs is latent heat of vaporization of water at the condenser surface of the last stage (J/kg), ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged...

Ngày tải lên: 05/09/2013, 16:11

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis...

Ngày tải lên: 07/09/2013, 13:48

... the diffraction of light through two slits separated by a • distance comparable to the wavelength results in an interference pattern of the diffracted waves an interference pattern is a characteristic ... measure of how intense the light is – the larger the amplitude, the brighter the light • the wavelength, (λ) is a measure of the distance covered by the wave the distance from one crest to the ... animation Tro, Chemistry: A Molecular Approach Characterizing Waves • the frequency, (ν) is the number of waves that pass a point in a given period of time the number of waves = number of cycles...

Ngày tải lên: 28/11/2013, 01:11

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... Subject The spaceship The planet They There The spaceship The two astronauts The woman It She We It Both of them They All plants and Animals They They Everything The man Nothing Something He I The...

Ngày tải lên: 12/02/2014, 20:20

... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...

Ngày tải lên: 14/02/2014, 14:20

... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... another single-domain phytase may improve the catalytic efficiency of the latter Materials and methods Strains, plasmids and chemicals E coli Trans1-T1 (TransGen, Beijing, China) and pGEM-T Easy ... sum of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according...

Ngày tải lên: 14/02/2014, 15:20

... the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation ... 1948, Dhaka and Urdu were declared West Bank might claim that the Bangladesh Liberation the of cial languages of all of Pakistan This proved War and the secession of East Pakistan was the result ... down the of ces of the pan-Arab Al have by facilitating the spread of Gaza’s lawlessness into the West Bank and ultimately to Israel Masked Fatah gunmen have occupied various PA fence, since large...

Ngày tải lên: 16/02/2014, 11:20

... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... because these are the most distant pair of haems in the structure and are therefore expected to have the weakest interaction [33] The pH dependence of the chemical shifts of the NMR signals of the ... that the spectra are very similar with respect to chemical shifts of the signals in intermediate stages of oxidation, and that formation of the complex does not lead to a marked decrease of the...

Ngày tải lên: 19/02/2014, 17:20

... data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade to pull, the ... system must allocate additional threads to allow the application to make progress while the I/O Facade task is blocked However, 2: Demarshaled data adding threads to the system has many negative consequences, ... guaranteed that its deadline will be met, based on the published parameters of each schedulable operation One advantage of our approach is that operation invocations only pay the overhead of the C++...

Ngày tải lên: 19/02/2014, 18:20

... data from the database These operators make calls to fetch data from the DBMS’ Transactional Storage Manager (Figure 1.1, bottom), which manages all data access (read) and manipulation (create, ... in all three DBMS models is that the buffer pool is a large shared data structure available to all database threads and/or processes When a thread needs a page to be read in from the database, ... in a database system This also serves as an overview of the remaining sections of the paper Consider a simple but typical database interaction at an airport, in which a gate agent clicks on a...

Ngày tải lên: 20/02/2014, 05:21

... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful ... aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases,...

Ngày tải lên: 21/02/2014, 03:20

... Annals of Mathematics, 159 (2004), 1247–1274 Numerical characterization of the K¨hler cone of a compact K¨hler manifold a a By Jean-Pierre Demailly and Mihai Paun Abstract The goal of this ... there exists a very neat characterization of nef classes on arbitrary surfaces, K¨hler or not a The Main Theorem has an important application to the deformation theory of compact K¨hler manifolds, ... can also view this fact as a characterization of the dual cone of the nef cone, in the space of real cohomology classes of type (n − 1, n − 1) This leads immediately to Corollary 0.4 In the case...

Ngày tải lên: 05/03/2014, 23:20

... that factor Xa cleaved and activated proHP8Xa When activated HP8Xa was mixed with proSpatzle¨ 1A, the 38 kDa pro-Spatzle band disappeared, and a ¨ 12 kDa product was produced (Fig 7A) N-terminal ... analysis using antiserum against M sexta HP8 Bands representing the proHP8Xa zymogen, a truncated form of proHP8Xa and the catalytic domain of active HP8 are marked with arrowheads The size and ... exchange chromatography SDS ⁄ PAGE analysis in the presence of b-mercaptoethanol indicated that the purified Spatzle had an ¨ apparent molecular mass of 38 kDa, which is slightly larger than that...

Ngày tải lên: 06/03/2014, 09:22

... Another insider installs a keystroke logger to get a few passwords to another computer in the same office • A database administrator makes an extra copy of the database files, but says the tapes ... Breakout sessions considered what databases would aid in this research if they were available Researchers need databases containing examples of specific attacks, the characterization of normal ... questions about modeling attackers as important items to discuss: • What are the defining characteristics and reasonable values for attacker models? • What are the observables (actions, artifacts) that...

Ngày tải lên: 06/03/2014, 16:20

... II of maltase is the catalytic nucleophile Because the Asp214 of maltase is equivalent to the Asp215 of isomaltase, a mutant with the residue altered to Ala was tested for its activity on a- pNPG ... YGR287c The sequence data for isomaltase is available from the DNA Data Bank of Japan with accession number AB109221 The entire coding region of the insert was amplified by PCR and subcloned into the ... Mun/Bpu and Mun/Bst were about 10 and 80 times lower than that of isomaltase, respectively The Km for a- pNPG of Mun/Bpu was the same as that of isomaltase, whereas the Km for a- pNPG of Mun/Bst was about...

Ngày tải lên: 07/03/2014, 16:20