the distinction between analytic and interpersonalor object relations therapy

... in the design and establishment of the process, coordinating with the people on the shop floor and making them understand, implementing the process, monitoring and correcting them Therefore, the ... management and the operators or workers working on the shop floor The technical staffs the work of understanding the top management requirements and policies and deploying them down the line The supervisor ... get the material in time The commercial people at purchasing cannot understand the importance of the items ordered, and they treat all as same, and for them the yardstick is the cost Once the...

Ngày tải lên: 28/06/2014, 17:20

... overview of the AGREE enterprise and general instructions on how to use the tool Then, for each of the 23 core items, it presents a definition of the concept and examples, advice on where the information ... one item targeting the PG’s overall quality and the second targeting the appraiser’s intention to use the PG The User’s Manual provides explicit direction for each of the 23 and two overall items, ... version of the AGREE II only) was very effective, and that there is a ceiling effect on performance measures and other outcomes Exploring these conclusions further, a significant component in the revision...

Ngày tải lên: 10/08/2014, 11:20

... from the needs of society, whereby people adjust their behavior to suit their interests and happiness and the progress of society in relation between humans and humans, between the individual and ... constructing and protecting the nation, and to satisfy the expectation of the society These are distinctive and indispensible standards of ethical profession for students to complete their duties 2.3.2 The ... society, the occupation itself against pedagogical workers; helping them with right knowledge, attitudes and behavior in their profession to complete the task Thereby, the thesis presents the theory...

Ngày tải lên: 24/08/2015, 04:45

... that the objectives of the IMO Model Course and the questions and exercises in the CBT package relate to the medium and higher levels of the taxonomy, viz application, analysis, synthesis and ... module within the Model Course and can be covered by information screens and multiple choice questions at the end of the section to verify the trainee’s understanding and knowledge of the subject ... section is to enable the trainee to understand, to modify and to optimise the ECDIS display The automatic display of the ship’s position and track is only safe and valuable in the appropriate chart...

Ngày tải lên: 09/05/2016, 16:54

... Vietnam and the South of Vietnam The structure of Vietnam’s SFC organization The supply chain quality management of interviewed SFCs The fish chain in the Netherlands The shrimp chain in the MD The ... at the Faculty of Management and Organization, Centre for Development Studies (CDS), the Faculty of Economics of the University of Groningen in the Netherlands, and the School of Economics and ... in the MD since the end of 1993 These have affected the quantity, quality and grading (size) of shrimp, which determine the export volume and value to global markets both in the short and in the...

Ngày tải lên: 23/04/2013, 09:34

... greatly expanded to the west and southwest The spatial growth of Hanoi is limited by natural barriers, such as streams to the northeast and east, water bodies to the north, and wetland to the south ... hand, relieve the overburdened center while, on the other hand, re-configure densities in what is already one of the most densely populated rural areas in the world (the “rural” component of the ... was originally wetland and agriculture, has became a modern New Town, combined to the “natural” landscape and green space, and created a motivation for the development of the southern gateway of...

Ngày tải lên: 29/08/2013, 08:15

... đình nhà chủ, 57,14% nhóm bán hàng rong 68,57% nhóm làm việc chợ lao động thuê trọ theo ngày (đêm), lại thuê nhà theo tháng Có khoảng 22,86% nữ lao động tự phải sống nơi có điều kiện sinh hoạt không ... lao động giúp việc “hài lòng” với công việc tại, tỷ lệ so với hai nhóm lao động tương đối cao, theo họ công việc không vất vả quê, thu nhập nhiều lao động gia đình chủ quan tâm 3.1.5 Định hướng ... họ tham gia vào đội ngũ lao động tự Họ phải làm công việc nặng nhọc với mức thu nhập thấp, kéo theo điều kiện sống mức tối thiểu, tạm bợ khu nhà trọ rẻ tiền với điều kiện sinh hoạt an ninh không...

Ngày tải lên: 29/08/2013, 08:15

... supported by the research project The research on the development of the total evaluation technique for the hazardous impacts by the chemical substances towards human and ecology (the project ... recommend the Ames test using these sensitive strains (especially YG1041 and/ or YG1042) in combination with the standard tester strains (TA98 and TA100 series), in order to detect the mutagenicity ... (1041, 1042) and their host TA strains (98, 100) 2-Nitrofluoranthene, 1-nitropyrene and 1,8-dinitropyrene are tested without S9mix, Glu-P-1 and Trp-P-2 are tested with S9mix using TA98 and YG1041...

Ngày tải lên: 05/09/2013, 08:40

... wastewater Damage from the shortage of water The damage [%•day] from the shortage of water is quantified by the product of the percent of deficiency to the water supply demand [%] and the period of deficiency ... death at the age of a+i and YLDi is the YLD during i years The DALY lost by the liver cancer for the population is obtained by summing up the products of four valuables of the cancer risk, the relative ... health risks by the DALY What is DALY? The Disability-Adjusted Life Years (DALY) is the sum of the Years of Life Lost (YLL) and the Years Lived with a Disability (YLD) The YLL indicating the lifetime...

Ngày tải lên: 05/09/2013, 09:08

... anoxic tank and 135L of aerobic tank, and a sedimentation tank Influent was 60L/day pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic tank The water temperature was 25oC-30oC The sludge ... of 10%, then transported to the laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the...

Ngày tải lên: 05/09/2013, 09:38

... 4oS and long 111oE, 116oE It is bounded to the northwest by the province of West Kalimantan, to the northeast by East Kalimantan, to the southeast by South Kalimantan, and to the southwest by the ... Water and Environment Technology, Vol 6, No.2, 2008 The average water flow during the rainy season in the Kahayan River is 400 m3/s and that in the Rungan is 165 m3/s During the dry season, the ... MATERIALS AND METHODS From 2004 to 2007, we took samples at 29 stations (19 in the Kahayan River and its tributaries and 10 in the Rungan River and its one tributary) Samples were taken from the Kahayan...

Ngày tải lên: 05/09/2013, 09:38

... from the fluorescent lamp to the top of the giant reeds was about 0.2 m at the start of the experiment The temperature in the experimental room was kept at about 28 °C The rhizomes and the roots ... Age and Wet Weight of the Giant Reed on Phosphorus Uptake Figure shows the relationships between the phosphorus uptake and the initial phosphorus concentration in various periods The sizes of the ... cropped before the start of the dying down period Then, after all of the above-ground part has died down, the whole plants including the roots and rhizomes are cropped except for the roots and rhizomes...

Ngày tải lên: 05/09/2013, 09:38

... Start by training them to listen to each other using non-verbal responses only Research shows that there is a strong link between the amount of eye contact people receive and their degree of participation ... as listen to them, particularly while they are performing tasks Look for signs of being bored or being lost Encourage your learners to make eye contact while they are working together in pairs ... group communication in the number of turns taken in a group conversation for example The NLP approach to eye contact is holistic and individualistic, but is soundly based on the premise that good...

Ngày tải lên: 06/09/2013, 10:10

... effectively However, in the thesis, the researcher wants to find out the attitudes, as well as the cultural awareness in teaching and learning spoken English of the teachers and the students of 10 ... embodies, and symbolizes cultural reality and in return cultural knowledge makes language alive Therefore, they co-exist and support each other The idea of the world is captured by culture And language ... because of both the use of linguistic codes and the ways they use the codes However, sometimes there is a thin line between them or between different “grammars” and different “ethnographic of speaking”...

Ngày tải lên: 07/09/2013, 13:00

... studies to build up a theoretical background for the research Then, as it was stated in the aims and scope of the study, we will collect the authentic exhibit labels in the Vietnam Museum of ... understand the concept 26 Example Lễ lẩu then người Tày = The ‘lau then’ ceremony of the Tay This object label is accompanied by a text panel which explained very clearly about the origin and meaning ... for description and analysis From these sources, we will analyse and draw out the methods and techniques used in the translation Furthermore, some translators who have translated the labels, will...

Ngày tải lên: 07/09/2013, 13:06

... investors at the prices they offer through their outlets, and provide depositing and clearing services to the investors B Roles of the government and the central bank in bond market development The government ... purely based on supply and demand of funds in the rural areas and the risk of lending; the floating band for lending rate of urban financial institutions will be further expanded while control of ... fundamentally, however they have increased the number of branches and staff In China’s case, it is a fact that the bigger the financial institutions are, the less possible for them to be closed The government...

Ngày tải lên: 18/10/2013, 07:15

... models; this leads to their having the analytic accessibility of the former within the framework of mean-field theory, as well as the finite connectivity of the latter Interest in these models has intensified ... with these low-lying, nearly degenerate ‘energy’ states On the other hand, there is only one way of covering the graph with the + + + state, which of course corresponds to the global minimum of the ... it, and so on to the top Note that the fluctuations of the power in the different frequency bands are strongly correlated; they correspond to sudden changes in the density (top-most trace) analytically...

Ngày tải lên: 01/11/2013, 08:20

... strategies in wetland conservation The inventories provide information on the type and the location of wetland, the economic and ecological value of the wetland, and the type and incidence of ... tide from the sea, yearly between 1.2 and 1.9 million hectares of land are inundated, mainly the Northern parts of the MD known as the LongXuyen quadrangle and the Plain of Reeds Along the 600 ... on the classification of forest wetlands, the inventory and mapping of wetlands, the mapping, and detailed description of the wetland’s diversity, and conducted applied research at regional and...

Ngày tải lên: 09/12/2013, 22:15

... competent to evaluate the significance and limitations of the information provided herein, and who will accept total responsibility for the application of this information The Portland Cement Association ... maintaining the NBI is to monitor the condition of bridges carrying public highways Therefore, for funding and reporting purposes, the FHWA considers only structures meeting the following criteria: • The ... from the inventory All new bridges must be inspected and added to the NBI Data on all bridges built in 2001 and 2002 may not have been entered into the 2003 NBI The delay may be due to a lag between...

Ngày tải lên: 20/12/2013, 20:15