the discovery and purification of a new enzyme

... located from the mid-cervical to the thoracic trachea increased the diameter of the entire cervical to thoracic tracheal area Coughing and dyspnea disappeared and the dogs resumed normal activity ... female, CT‐TT: cervical trachea to thoracic trachea Fig Lateral radiographs before (a) and after (b) intratracheal placement of self expandable nitinol stent with flare ends in a dog with tracheal ... implantation, the respiratory dyspnea in all dogs improved dramatically, and the dogs resumed almost normal activity Between and months after implantation, the dyspnea caused by tracheal collapse showed...

Ngày tải lên: 07/08/2014, 20:23

... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... purpuratus, the nematode C elegans, the fruitflies D melanogaster and D pseudoobscura, the mosquitoes A aegypti and A gambiae, the clam T gigas and larval sequences from the cnidarian F scutaria Finally, ... in the Archaea and Bacteria domains [11] Among the broad range of physiological processes in which they participate, CA can play a significant role in autotrophic organisms, serving as an inorganic...

Ngày tải lên: 18/02/2014, 16:20

... DNA with the oligonucleotides TG100 (5¢-GGCCTCATGAAGAAAAAGGTCGTCA TAATT-3¢), and TG101 (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA ... and assayed as above Thiols were quantified by comparison of peak areas to standard curves of those standards Coenzyme A was measured as the sum of the areas of the CoA and dephospho CoA peaks, as ... (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P furiosus CoADR The N terminus of the CoADRs were based on the presence and proper spacing of the ribosome...

Ngày tải lên: 07/03/2014, 17:20

... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... file back sequentially, then writes 100 Mbytes randomly to the existing file, then reads 100 Mbytes randomly from the file, and finally reads the file sequentially again The bandwidth of each of the...

Ngày tải lên: 12/09/2012, 15:05

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... explore the meaning and structure of Torquay? But I said Turkey! as a text The analysis is based on the framework of Hallidays (1994)An Introduction to Functional Grammar, Halliday and 21 Hasans ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis...

Ngày tải lên: 07/09/2013, 13:48

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... Subject The spaceship The planet They There The spaceship The two astronauts The woman It She We It Both of them They All plants and Animals They They Everything The man Nothing Something He I The ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg...

Ngày tải lên: 12/02/2014, 20:20

... registration, location, and actiThe CORBA Event Service model simplifies application vation; request demultiplexing; framing and error-handling; parameter marshalling and demarshalling; and operation ... data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade to pull, the ... such as Forward Looking Infrared Radar, requires a new Sensor Proxy, I/O Facades must be altered to take advantage of the new technology ample has the following participants: Aircraft Sensors: Aircraft-specific...

Ngày tải lên: 19/02/2014, 18:20

... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) Glycine, ... (Little Chalfont, UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich ... h The amount of Bip-Pro in the extracellular uptake medium was quantified according to the laboratory standard HPLC (La-ChromÒ; Merck-Hitachi, Darmstadt, Germany) with a diode array detector and...

Ngày tải lên: 07/03/2014, 05:20

... components of each reaction mixture, after their chromatographic separation and purification, were submitted to 1H NMR (nuclear magnetic resonance) and FABMS (fast atom bombardment mass spectrum) analyses ... carnation The position of molecular mass markers are indicated in kDa F 4¢-OMT activity towards the different assayed substrates, transformation products and kinetic analysis The enzyme became inactive ... structures of the hydroxybenzoic acid (I, II) and hydroxycinnamic acid (III, IV) derivatives assayed as substrates for the flavonoid 4¢-OMT The carnation cultivar ÔNovadaÕ was obtained from the DLO...

Ngày tải lên: 08/03/2014, 08:20

... between the vector-borne ShineDalgarno sequence and the N-D-AAase start codon The sequence upstream of the N-D-AAase gene is: 5¢…AGGACAGACGAATG…3¢ (The Shine-Dalgarno sequence and start codon are ... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... substrate specificity of the N-D-AAase protein, the activity of the enzyme against N-acyl-D- or L-amino acids and other D-amino acid derivates was determined (Table 3) The substrates analysed were a...

Ngày tải lên: 08/03/2014, 16:20

... expressed and purified from E coli was analyzed Native PAGE analysis showed that the wild-type AATB3 had AAT activity when l-aspartate and the a- ketoglutarate were used as amino donor and acceptor, ... (Fig 2C) In the paper chromatography analysis of amino acids (Fig 3), the AATB3 also demonstrated the ability to transfer the a- amino of the l-tryptophan to a- ketoglutarate and oxaloacetate to produce ... GAATTCTCAGCCTGATATTTCCGCCT (EcoRI) CGTGCTCGTAAACGATGCGTATTAC ACAATCTCTTTGCCGGCCTCCGC GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC firmed by sequencing (Invitrogen...

Ngày tải lên: 14/03/2014, 23:20

... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference ... up the dimensions) There are also severalopen researchissuesin the design of systemsbasedon the E-ADT paradigm, and in extensions of the paradigm to handle optimizations that spandata types Acknowledgements ... usedfor a specific value may be specified by the userwhen the valueis created,or determinedautomatically by the system Catalog Management: Each E-ADT can provide catalogs that maintain statisticsand...

Ngày tải lên: 16/03/2014, 16:20

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...

Ngày tải lên: 23/03/2014, 21:20

Ngày tải lên: 23/03/2014, 22:21

... Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap Vcap −Vcap −Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap −2Vcap −Vcap Vcap 2Vcap Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap Vcap 2Vcap −2Vcap 2Vcap 2Vcap −2Vcap −2Vcap ... IMPLEMENTATION Phase A Phase a VAB = 0V VCA = 0V Vab = 0V Phase B Phase b Phase c Phase C -Vcap+ Phase A Phase a ap+ -Vc VAB = V Vab = Vcap Phase B Phase b Phase c Phase C -Vcap+ Phase A Phase a VAB ... Vca = 0V Vbc = -Vcap Phase c Phase a Phase b Vca = 0V Vbc = -Vcap -V ca p+ Phase B VBC = Vcap - - Vab = Vcap ca VCA = 0V -V VAB = -Vcap - -Vcap+ Phase A cap cap Vab = Vcap ap VCA = Vcap c -V VAB...

Ngày tải lên: 13/05/2014, 00:55

... Leiomyosarcoma Melanoma Ovarian carcinoma Ovarian sarcoma Pancreatic cancer Pharyngeal cancer Plasmocytoma Pleural mesotelioma Prostatic cancer Rectum carcinoma Thymic carcinoma Thyroid carcinoma Tonsillar ... clinical and treatment characteristics of the participants Participants with malignancies had a broad range of tumour localisations (table 3) At the time of being surveyed, at least two weeks had ... Puhlemann and Lisa Arndt for recruitment of participants and Dagmar Brauer for the database documentation and lecture MK, RZ, DB Page 10 of 11 (page number not for citation purposes) Health and Quality...

Ngày tải lên: 18/06/2014, 18:20

... development of the AF6 and in the writing of the manuscript BN: participated in the data analysis, in the preparation of tables and writing of the manuscript KK: gave scientific input regarding the statistical ... statistical methodology, the analysis of the results and in the writing of the manuscript 11 12 13 14 JC: made statistical analyses and gave scientific input in the analysis of the results and in the ... generic measure Mental state, depression, worry and anxiety seem to play important roles and may affect the relapse rate of AF as well as the symptomatology and the quality of life [26,27] 'Anxiety...

Ngày tải lên: 18/06/2014, 18:20

... work was supported in part by an Ontario Graduate Scholarship, Natural Sciences and Engineering Research Council of Canada and the Canada Research Chairs program The authors acknowledge Mr Ka Lun ... the manuscript TC conceived the study, advised on the design and coordination of the experiments, and edited the manuscript All authors read and approved the final version of the manuscript Acknowledgements ... factor was selectable in the 1.2-2.5 range, and was adjusted for each participant such that false activations due to blinks and movement were avoided and participants were able to activate the switch...

Ngày tải lên: 19/06/2014, 08:20

... schematic diagramand for rotavirus RNA Comparison and( b) Northern blot analysis the variant 311 of Comparison between the YK-1 strain and its variant 311 by (a) plaques size, (b) Northern blot analysis ... simian rotavirus was isolated from the diarrheal stool of a 2-year-old pigtailed macaque (Macaca nemestrina) housed at the Yerkes National Primate Research Center, Emory University (Atlanta, GA) ... After a h incubation at 37°C, the inoculum was aspirated and ml of a 3.5% agarose (Seakem, Biowhittaker, Rockland, ME) in MEM was overlayed on the monolayer The agar was allowed to solidify at room...

Ngày tải lên: 20/06/2014, 01:20

... development of the AF6 and in the writing of the manuscript BN: participated in the data analysis, in the preparation of tables and writing of the manuscript KK: gave scientific input regarding the statistical ... statistical methodology, the analysis of the results and in the writing of the manuscript 11 12 13 14 JC: made statistical analyses and gave scientific input in the analysis of the results and in the ... generic measure Mental state, depression, worry and anxiety seem to play important roles and may affect the relapse rate of AF as well as the symptomatology and the quality of life [26,27] 'Anxiety...

Ngày tải lên: 20/06/2014, 16:20