the contribution of neuropsychology to archaeology sophie a de beaune
Báo cáo khoa học: "THE CONTRIBUTION OF PARSING TO PROSODIC PHRASING IN AN EXPERIMENTAL TEXT-TO-SPEECH SYSTEM" doc
Ngày tải lên :
24/03/2014, 02:20
... many cases it appears that the grammatical relation of the final constituent to the rest of the sentence determines the boundary value that sets off this constituent In particular, sentence adjuncts, ... the s)ntax tree and it is difficult to determine whether the) ' integrate the material in the comptemennzer Wltla the material in the core sentence as they are analy.zing the material in the core ... reading of (31), naturally modifies the verb speak; i.e., the informants were to speak in a natural manner O n the other reading, naturally is an adjunct equivalent to of course (To see this m e a...
- 11
- 287
- 0
Báo cáo y học: "The contribution of dance to daily physical activity among adolescent girls" pdf
Ngày tải lên :
14/08/2014, 08:20
... directors agreed to participate, and those directors provided the schedules of the ballet, jazz, and tap classes that were offered to students aged 11 years and older In each of the 11 dance ... days are the same day of the week [18] In this study, the accelerometers were put on (day 1) and taken off (day 8) on the same day of the week, and for data reduction, a single day of data was ... data, leaving 134 included in the data analyses Due to the three analytical methods, there were three analytic samples; the descriptive characteristics of the three samples are presented in Table...
- 8
- 203
- 0
Báo cáo sinh học: "Assessing the contribution of breeds to genetic diversity in conservation schemes" pps
Ngày tải lên :
14/08/2014, 13:21
... diversity to variation in quantitative traits, putting less emphasis on the conservation of rare alleles and more on the conservation of a wide range of genotypes Due to the nature of the optimisation ... genetic variation of the hypothetical founder population It may be noted that exclusion of a breed causes an adjustment of the contributions of the remaining populations in such a way that the loss ... moderately to substantially when added to the Safe set (Tab III) The contributions of breeds to the core set are not very closely related to the loss due to exclusion of the breed For instance,...
- 21
- 188
- 0
Tài liệu The Contribution of Sexual and Reproductive Health Services to the Fight against HIV/AIDS: A Review pptx
Ngày tải lên :
13/02/2014, 15:20
... cells of the cervix, vagina, anal and genital area, and a higher incidence of cervical intraepithelial neoplasia (CIN) and advanced cervical disease, and at younger ages, than women in the general ... primarily to provide family planning Because of their advantages in terms of outreach and a peer education approach, several efforts have been made to train CBD providers to include STI and HIV/AIDS ... mind their dual responsibility to provide optimal care to the mother and reduce the likelihood of MTCT of HIV ‘ The core goal of all medical therapy is to bring the patient’s viral load to an undetectable...
- 23
- 719
- 0
Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf
Ngày tải lên :
17/02/2014, 22:20
... relationships between AFQT and years of experience or additional training are linear Rather, the authors note that although the magnitude of the trade-off may vary, it is at least one -to- one and ... that increasing the percentage of new crew members from one standard deviation below the mean to one standard deviation above the mean leads to a decrease of about eight percentage points in the ... did any of the other variables In an effort to quantify the effect of AFQT on performance in their model, the authors note that the effect of a one-level change in AFQT category appeared to equal...
- 87
- 627
- 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
Ngày tải lên :
09/08/2014, 08:22
... of the MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and ... metalloproteinase (96-kd gelatinase B) in human rheumatoid arthritis Arthritis Rheum 1996, 39:1576-1587 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... La Fondation Armand-Frappier and the Canadian Arthritis Network 16 17 References Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular...
- 10
- 494
- 0
A computational study to investigate the effects of insulation and EGR in a diesel engine
Ngày tải lên :
05/09/2013, 16:11
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering, ... cylinder wall and the cylinder wall opposite to the pre-chamber at approximately the same time It reveals that the flame started in pre-chamber and then invades a large portion of the main-chamber...
- 20
- 643
- 0
Tài liệu Báo cáo khoa học: "The Contribution of Linguistic Features to Automatic Machine Translation Evaluation" docx
Ngày tải lên :
20/02/2014, 07:20
... 5.2.1 Ability to Deal with Translations that are Dissimilar to References Analysis of Evaluation Samples In order to shed some light on the reasons for the automatic evaluation failures when assigning ... improves the human-aided translation th according to the automatic metric m Formally the averaged quality decrease is: OST(m) = Avgc (Qh (Argmaxt (Qm (t))|t ∈ c)) We use the sum of adequacy and fluency, ... lexical, syntactic, and semantic In all cases, translation quality is measured by comparing automatic translations against a set of human references At the lexical level, we have included several...
- 9
- 514
- 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
Ngày tải lên :
07/03/2014, 00:20
... (RRA) approach to initial project preparation was developed By the end of the decade, there was a range of RRA methods and approaches available which then gave rise to participatory rural appraisal ... different area or family are disadvantaged, as they have to work their way in and probably have to learn the hard way, by learning from their mistakes The SLA embraces a wider approach to people’s ... interchangeable For example, natural capital may be the basis for financial capital (land as collateral that can be used to obtain a loan) Or natural capital might be linked to social capital In many societies,...
- 95
- 645
- 0
Báo cáo khoa học: Structure of coenzyme F420H2 oxidase (FprA), a di-iron flavoprotein from methanogenic Archaea catalyzing the reduction of O2 to H2O ppt
Ngày tải lên :
07/03/2014, 10:20
... as electron acceptor (apparent Km ¼ lm), with an apparent Vmax of the purified enzyme of 180 s)1 [3] Coenzyme F420 is a 5-deazaflavin derivative, and as such transfers hydride anions rather than ... considering that F420 is a deazaflavin (771 Da) that transfers hydride Fig Structures of F420H2 and of FMNH2, both viewed from the Si face The Re and Si faces of the flavin isoalloxazine ring are de ned ... with the hkl [45] and xds [46] packages The quality of the data and crystallographic parameters are summarized in Table The structure of the enzyme based on the air-exposed monoclinic crystals was...
- 12
- 563
- 0
Báo cáo khoa học: Investigation of the contribution of histidine 119 to the conduction of protons through human Nox2 pptx
Ngày tải lên :
07/03/2014, 16:20
... CTCAGCTAAGCTTGCCACCATGGGGAAC AGCTGAGGATCCCTACCCACGTACAATTCG CAATGGTGTGAATCGCAGAGAGAAGTG TGCGATTCTCACCATTGCACATCTATTT CAATGGTGAGAATCGCAGAGTGAAGTGC TGCGATTCACACCATTGCACTTCTATT CAATGGTGTGAATCGCAGTGAGAAGTG ... pH of the viral particle, leading to dissociation of the viral coat and release of the viral genome [17,22] Amantidine, an anti-influenza drug, acts as an inhibitor of the influenza A M2 proton ... (A E) The opening of the proton conduction pathway and the transport of protons was monitored as an alteration in internal pH, following the addition of 10 lM arachidonic acid (AA) The maximum change...
- 8
- 305
- 0
Báo cáo khoa học: The binding of IMP to Ribonuclease A pptx
Ngày tải lên :
07/03/2014, 21:20
... accessible areas were calculated with the program naccess [56] Atomic coordinates and the X-ray amplitudes of the RNase A IMP, and RNase A AMP, complexes have been deposited in Research Collaboratory ... the active site of RNase A The map was calculated from the RNase A model before incorporating the coordinates of AMP and is contoured at 1.0 r level The refined structure of the inhibitor is also ... also avail˚ able at 2.0 A resolution Preliminary analysis of this structure showed that the inhibitor is bound in exactly the same way as in the soaked crystal Upon binding to RNase A each of the...
- 14
- 360
- 0
A Designer''''s Guide to Adobe InDesign and XML: Harness the Power of XML to Automate your Print and Web Workflows pptx
Ngày tải lên :
14/03/2014, 23:20
... claimed as trademarks Where those designations appear in this book, and Peachpit was aware of a trademark claim, the designations appear as requested by the owner of the trademark All other product ... plain-text database Terms and Definitions As a graphic designer, you’re probably a visual communicator We understand that you’re not a code freak and are probably not a fan of acronyms, initials, or abbreviations, ... disparate entities together and makes a whole world of data-intensive applications possible (Basically, a meta language is a set of rules, syntax, and context that can be used to define other languages.)...
- 337
- 6.1K
- 0
Funding Higher Education: The Contribution of Economic Thinking to Debate and Policy Development docx
Ngày tải lên :
17/03/2014, 08:20
... terms has made the receipt of a loan – rather than a grant – somewhat more palatable to students and the public” (Jackson 2002, 90) Johnstone’s criticism of the idea of ICLs or a graduate tax in ... (China), Korea, Philippines, and Thailand) and identifies a number of administrative weaknesses, including lack of adequate financial appraisal, forward planning, monitoring and evaluation, as ... proportion of a graduate’s income Chapman, one of the main advocates of ICLs explains the crucial difference: The critical and defining characteristic of an ICL is that the collection of the debt depends...
- 59
- 378
- 1
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc
Ngày tải lên :
29/03/2014, 07:20
... that altogether they may make up exactly the same sum total as before Ignorant of this fact, and flattering themselves with the idea that they could increase capital at pleasure, the British banks, ... the rated value of the stock of the company This edict was instantly fatal to the circulation of the notes Apart from the shock it gave to their credit, and as one edict had taken away half their ... were enabled to weather the storm; and after the month of May, the Bank was considered out of danger But the Bank was saved, as always happens in such cases, by the ruin of individuals The sudden...
- 78
- 775
- 0
A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc
Ngày tải lên :
29/03/2014, 19:20
... predictions are available in a searchable database online at the site Imagining the Internet: A History and Forecast and they are also the basis for a book by Anderson titled Imagining the Internet: ... to have a fair chance to succeed and prosper.” Tiffany Shlain, founder of the Webby Awards, wrote, “Giving all people access to information and a context to understand it will lead to an advancement ... trial and error or through example and generalization MEMS, agents and bots are the reality today In the near future, as computing and data storage become more advanced and nanotechnology and artificial...
- 115
- 441
- 0
THE EXPOSURE OF YOUTH TO UNWANTED SEXUAL MATERIAL ON THE INTERNET: A National Survey of Risk, Impact, and Prevention pdf
Ngày tải lên :
29/03/2014, 19:20
... tuned to a channel, has to involuntarily accept whatever is broadcast, to a greater extent than a medium like a bookstore, where the audience can choose what to look at, what to buy, and what to ... opposed to governmental and any other centralized form of regulation is that another, less onerous, option is available to deal with the problem, so that regulatory measures are not warranted The alternative ... symptom of stress at the level of more than a little or all the time during the days right after the incident happened In another series of bivariate analyses, few of the characteristics of the youth,...
- 29
- 529
- 0