the classes used to implement undo in a command pattern implementation
It’s Not You, It’s Your Strategy: The HIAPy Guide to Finding Work in a Tough Job Market
Ngày tải lên :
09/02/2014, 20:53
... are many areas of the country where the job pool has been devastated, and also many industries that have been devastated, including automobiles, manufacturing, textiles, airlines, media and information ... news, since it means you’re only really competing against the remaining 15% The bad news, however, is that that 15% is playing at the top of their game – and the only way to compete is to the same: ... closely to what they are saying and your best to follow their advice www.hillaryrettig.com / page 48 Because many job seekers tend to be ashamed and insecure, they have a natural inclination toward...
- 48
- 560
- 0
The HIAPy Guide to Finding Work in a Tough Job Market by Hillary Rettig
Ngày tải lên :
19/03/2014, 12:32
... are many areas of the country where the job pool has been devastated, and also many industries that have been devastated, including automobiles, manufacturing, textiles, airlines, media and information ... news, since it means you’re only really competing against the remaining 15% The bad news, however, is that that 15% is playing at the top of their game – and the only way to compete is to the same: ... closely to what they are saying and your best to follow their advice www.hillaryrettig.com / page 48 Because many job seekers tend to be ashamed and insecure, they have a natural inclination toward...
- 48
- 614
- 0
báo cáo khoa học: " Part I, Patient perspective: activating patients to engage their providers in the use of evidencebased medicine: a qualitative evaluation of the VA Project to Implement Diuretics (VAPID)" pps
Ngày tải lên :
10/08/2014, 10:22
... approach was chosen to minimize variation among interviewers and to facilitate a systematic means of gathering data and conducting analysis of responses, while at the same time allowing for individualized ... First, the study was restricted to a sample of predominately white male VA patients The findings may be unique to the VA, as many veterans appear to exhibit a sense of obligation that may influence ... conceptualizing, drafting, and revising the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: 12 January...
- 11
- 325
- 0
Báo cáo y học: "A cross-sectional study of the number and frequency of terms used to refer to knowledge translation in a body of health literature in 2006: a Tower of Babel?" pps
Ngày tải lên :
11/08/2014, 05:21
... training assistance in implementing the reading/categorizing guidelines and inter-rater reliability checks KAM, CL, and NLW planned and carried out the analyses and interpretation of the data All ... for the variation in terminology that exists in KT research and application In addition to being an emerging domain that crosses multiple disciplines, many countries are working in the KT area They ... educational material Each article in the database was classified as being about KT or not about KT An example of a KT paper is one by Shojana and colleagues [17] They discuss their thoughts about...
- 11
- 598
- 0
Báo cáo y học: " Part I, Patient perspective: activating patients to engage their providers in the use of evidencebased medicine: a qualitative evaluation of the VA Project to Implement Diuretics (VAPID)" ppsx
Ngày tải lên :
11/08/2014, 05:21
... approach was chosen to minimize variation among interviewers and to facilitate a systematic means of gathering data and conducting analysis of responses, while at the same time allowing for individualized ... First, the study was restricted to a sample of predominately white male VA patients The findings may be unique to the VA, as many veterans appear to exhibit a sense of obligation that may influence ... conceptualizing, drafting, and revising the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: 12 January...
- 11
- 391
- 0
A computational study to investigate the effects of insulation and EGR in a diesel engine
Ngày tải lên :
05/09/2013, 16:11
... [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed compression-ignition engine International ... NOx As shown in Figure 11e, at 380°CA, the NO forms in the swirl chamber throat, pre and main chambers and then transferred into the main chamber at 400°CA for baseline engine While at adiabatic ... lateral cylinder wall and the cylinder wall opposite to the pre-chamber at approximately the same time It reveals that the flame started in pre-chamber and then invades a large portion of the main-chamber...
- 20
- 643
- 0
Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx
Ngày tải lên :
19/02/2014, 16:20
... eugenin of Macropus eugenii young R V Baudinette et al Fig The young of Macropus eugenii (A) climbing into the pouch and (B) attached to a teat marsupials (including the Tammar wallaby) [8] There ... was approved by The University of Adelaide Animal Ethics Committee Acetylcholine, atropine, concanavalin A, CCK-8 and CCK-8-NS were obtained from Sigma-Aldrich Alamar blue was obtained from Astral ... 16 Wakabayashi H, Matsumoto H, Hashimoto K, Teraguchi S, Takase M & Hayasawa H (1999) Inhibition of iron ⁄ ascorbate-induced lipid peroxidation by an N-terminal peptide of bovine lactoferrin and...
- 11
- 638
- 0
Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt
Ngày tải lên :
18/06/2014, 16:20
... intra-peritoneal injection of 400 mg/kg chloral hydrate (Pharmaceutical Plant of Tiantan Hospital, Beijing, China) The rectal temperature was monitored and maintained at 37.5°C A scalp incision was made ... B, top row) Reddish-brown staining of Class II MHC was evident in the infarcted brain parenchyma (B-i), along the meninge (B-ii), areas near the ventricular lining and vascular wall near the ... test YHA participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have...
- 10
- 701
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
Ngày tải lên :
20/06/2014, 15:20
... single domain (interpersonal care) because they formed a more clinical and statistical cohesive set together rather than existing as separate scales For the same reasons, three domains (physical comfort, ... study including the design and coordination All authors contributed to the interpretation of data and writing of the manuscript All authors read and approved the final manuscript Competing interests ... could also be generated that could discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also...
- 8
- 492
- 0
Báo cáo khoa học: "Successful radiation treatment of anaplastic thyroid carcinoma metastatic to the right cardiac atrium and ventricle in a pacemaker-dependent patient" pps
Ngày tải lên :
09/08/2014, 09:20
... right cardiac atrium and ventricle in a pacemaker-dependent patient Tina Dasgupta*, Igor J Barani, Mack Roach III* Abstract Anaplastic thyroid carcinoma (ATC) is a rare, aggressive malignancy, ... treatment of cardiac metastases encasing the leads of a pacemaker, and of cardiac metastases from ATCs, with a review of the pertinent literature Background Anaplastic thyroid carcinoma (ATC) ... He was treated with a total thyroidectomy for anaplastic thyroid carcinoma in March 2008, followed by post-operative cisplatin-based chemo-radiation therapy to the surgical bed and the draining...
- 8
- 328
- 0
Báo cáo khoa hoc:"Effect of the slow (K) or rapid (k +) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn × brown egg type cross" ppsx
Ngày tải lên :
09/08/2014, 18:21
... sex The K gene did not appear as an adaptation factor to heat, at least in light or median-size lines We also observed that the sex-linked feathering genes did not in uence the abdominal fat deposition ... especially concerning remiges and rectrices At one day of age, the primary and secondary feathers are like coverts in a slow feathering chick, and at eight days they not have tails Owing to the ... weeks of age Plumage weight was calculated as an absolute value and per cent of body weight, as for males in individual cages 2.4 Statistical analysis Analysis of variance with unequal subclass numbers...
- 12
- 344
- 0
báo cáo khoa học: " Part II, Provider perspectives: should patients be activated to request evidence-based medicine? a qualitative study of the VA project to implement diuretics (VAPID)" potx
Ngày tải lên :
10/08/2014, 10:22
... of the codes and making coding more consistent The final consensus was then entered into NVivo 8, a software package for qualitative data management and analysis [38] The remaining 21 total transcripts ... prescribed a thiazide Patients in arm C received the letter and financial incentive, as well as a phone call from a health educator to remind them of the letter and to answer any questions about the intervention ... therapy For example, one cautioned against targeting geriatric patients for thiazides, explaining that too often there are too many complications, and another explained if clinic rather than home...
- 12
- 495
- 0
báo cáo khoa học: " The NIHR collaboration for leadership in applied health research and care (CLAHRC) for Greater Manchester: combining empirical, theoretical and experiential evidence to design and evaluate a large-scale implementation strategy" pptx
Ngày tải lên :
10/08/2014, 11:20
... people in the right roles to maximize the chances of success; and finally, we need to adopt a formative approach to implementation and evaluation, reflecting, and learning along the way Taking account ... implementation team and NHS organizations involved in the CLAHRC activities, and act as the main facilitators of change in the field KTAs are supported by an academic lead, who provides the link to the ... and, finally, to enhance the interconnectedness of the implementation themes and integrity of the programme as a whole This paper outlines the GM CLAHRC approach to designing and evaluating a...
- 12
- 295
- 0
Báo cáo y học: "Part II, Provider perspectives: should patients be activated to request evidence-based medicine? a qualitative study of the VA project to implement diuretics (VAPID)" ppsx
Ngày tải lên :
11/08/2014, 05:21
... of the codes and making coding more consistent The final consensus was then entered into NVivo 8, a software package for qualitative data management and analysis [38] The remaining 21 total transcripts ... prescribed a thiazide Patients in arm C received the letter and financial incentive, as well as a phone call from a health educator to remind them of the letter and to answer any questions about the intervention ... therapy For example, one cautioned against targeting geriatric patients for thiazides, explaining that too often there are too many complications, and another explained if clinic rather than home...
- 12
- 348
- 0
báo cáo khoa học: "Organizational interventions to implement improvements in patient care: a structured review of reviews" pptx
Ngày tải lên :
11/08/2014, 05:21
... that the available evidence was difficult to locate, even for expert researchers, and may therefore be largely inaccessible to health care managers [7] There was a range of organizational approaches ... methodological quality had not used optimal procedures for data-extraction and data-analysis The studies were too heterogeneious regarding strategies and context factors to allow statistical pooling; ... Disease management and case management in diabetes Ram 2001 N=1 Stroke Unit Trialist Collaboration 1997 N = 19 Asthma clinics in primary care Weingartenn 2002 N = 102 Organized inpatient care after...
- 9
- 293
- 0
Báo cáo y học: " Characterization of the innate immune response to chronic aspiration in a novel rodent model" ppsx
Ngày tải lên :
12/08/2014, 15:21
... ketamine (40 mg/kg IM), intubated orotracheally using the sheath from a 14-gauge IV catheter, and maintained on a mechanical ventilator (Inspira, Harvard Apparatus, Holliston, MA) Rats were subsequently ... the ventilator and placed in the left lateral decubitus position with their head elevated at a 30° angle A silastic catheter was inserted through the endotracheal tube to a distance mm past the ... http://respiratory-research.com/content/8/1/87 Figure Instillation of fluid into the left lung Instillation of fluid into the left lung The instillation of gastrograffin into the distal trachea of sedated rats in the left lateral decubitus...
- 12
- 330
- 0
Báo cáo y học: "The limited utility of electrocardiography variables used to predict arrhythmia in psychotropic drug overdose" pps
Ngày tải lên :
12/08/2014, 19:22
... abnormality The QRS, the QTc and the R/S ratio in aVR appeared to be most strongly related to arrhythmia, although there was no clear separation of the groups The raw data (Figs 1–3) indicate that the ... assumption that the purpose of the ECG is to identify patients at risk of any sustained arrhythmia, and therefore arrhythmias were defined as sustained tachyarrhythmias (supraventricular tachycardia [SVT] ... efforts have been made to identify those at risk using findings on the electrocardiograph The electrocardiography (ECG) findings examined have included the QRS duration, the QT interval duration, and...
- 7
- 237
- 0
Báo cáo y học: "Origin of nascent lineages and the mechanisms used to prime second-strand DNA synthesis in the R1 and R2 retrotransposons of Drosophila" doc
Ngày tải lên :
14/08/2014, 21:20
... TTCGATGGTGGAGTGACGCGCATGAATGGCTTAACGACGGACGTGTT M (8) AATATTTGGGTATTTATAATTACAAG M (9) AGAGGACGCACCGTGAACTAA -9 AGAGGATGCACATGAATGGATTAACGACGGACGTGTT -9 AATATTCTGGTATTTATGAATGGATTAACGACGGACGTGTT M (10)TCCATAAGTCGCTAGAAGAAT -9 TCCATAAGCCGCGCATGAATGGATTAACGACGGACGTGTT ... 5’ truncated R2s f R2 28S v GTAACTATGACTCTCTTAAGGAAGATGCAT g GTAACTATGACTCTCTT A GCTAAGACAGA h GTAACTATGACTCCCTTGGGAGT i GTAACTATGACTCTCTTAAGG CATTAACTA TGACAGACGGAC -3 v -8 v v (c) 28S target ... cleavage location was needed (a) Volume 10, Issue 5, Article R49 Stage and Eickbush R49.6 3’ junctions AAAAAAAAAATAGCCAAATGCCT 99% AAAAAAAAAAAAGCCAAATGCCT 1% (b) Full length R2s a R2 28S v GTAACTATGACTCTCTTAAGGGGATCATGGG...
- 17
- 240
- 0