the beginning or end of a century 906

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... rotamer normality correspond to Z-scores and therefore a positive value indicates better than average and their maximum values are around The values for all these parameters obtained for the PsbQ ... good and the programs did not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the...

Ngày tải lên: 21/02/2014, 00:20

12 550 0
The Citizen-Soldier or, Memoirs of a Volunteer potx

The Citizen-Soldier or, Memoirs of a Volunteer potx

... or the day after, if they not leave, a battle will take place Our men appear eager for the fray, and I pray they may be as successful in the fight as they are anxious for one 29 It is half-past ... generals are too d d slow (hic)." The Major is a man of excellent natural capacity, the son of Hon Thomas Ewing, of Lancaster, and brother-in-law of W T Sherman, now a colonel or brigadier-general ... was also of the party He is fifty or fifty-five years old, a thin, spare man, of very ordinary personal appearance, but of fine scientific and literary attainments For some years he was a professor...

Ngày tải lên: 17/03/2014, 02:20

143 535 0
History of Cuba; or, Notes of a Traveller in the Tropics pdf

History of Cuba; or, Notes of a Traveller in the Tropics pdf

... fine large harbors; those of Havana, Niepe and Nuevitas, are among the best The bay of Matanzas is also capacious; Cardenas and the roadstead of Sagua la Grande have plenty of water for brigs and ... Bayamo, CHAPTER I 22 Camaguey, Jagua, Cueyba, Habana and Haniguanica At the head of each was a governor, or king, of whose laws we have no record, or even tradition An unbroken peace reigned among ... Decadence of Spanish power History of Cuba The rovers of the Gulf Havana fortified The tyrant Velasquez Office of captain-general Loyalty of the Cubans Power of the captain-general Cupidity of the...

Ngày tải lên: 24/03/2014, 03:21

109 354 0
The financial reporting framework may not provide specific guidance for inclusion or exclusion of a docx

The financial reporting framework may not provide specific guidance for inclusion or exclusion of a docx

... auditing and assurance standards and by facilitating the convergence of international and national standards, thereby enhancing the quality and uniformity of practice throughout the world and strengthening ... Example of Basis for Qualified Opinion and Report on other legal and regulatory requirement for use in the public sector Appendix of ISA 600 contains an example of an auditor’s report containing a ... in the private sector, or materiality for components may also be assessed at a low level This may occur for a variety of reasons, including the context of the matter, or the nature and characteristics...

Ngày tải lên: 19/06/2014, 21:20

10 176 0
Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx

Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx

... Journal of Biology 2008, 13 Sasamura T, Ishikawa HO, Sasaki N, Higashi S, Kanai M, Nakao S, Ayukawa T, Aigaki T, Noda K, Miyoshi E, Taniguchi N, Matsuno K: The O-fucosyltransferase O-fut1 is an ... ER markers seen by Sasamura et al [13] Okajima et al [17] therefore propose that Notch accumulates in ofut1 mutant Acknowledgements We thank A Bardin and C Perdigoto for critical reading of the ... Although the catalytic and non-catalytic activities of Ofut1 can be experimentally uncoupled, it is attractive to speculate that the O-fucosylation activity of Ofut1 participates in the quality-control...

Ngày tải lên: 06/08/2014, 18:21

5 419 0
Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

... Administration approved therapy for the treatment of rheumatoid arthritis but not for OA due to its limited and short-term effectiveness Maintaining a balance in levels of IL-1β might be important as a ... radiation-induced inflammation-associated skin diseases including skin cancers [9,10] The physician and the patients want to understand the real targets and mechanism of action of GTPs that lead to the prevention ... treatment approach for OA, and agents such as GTPs could fill the gap In fact, complete deletion of the Il1b gene leads to disease exacerbation in a mouse model of OA, suggesting both a catabolic...

Ngày tải lên: 12/08/2014, 17:22

2 338 0
Báo cáo y học: "NICE-SUGAR: the end of a sweet dream" pdf

Báo cáo y học: "NICE-SUGAR: the end of a sweet dream" pdf

... AH, Quintero AM, Gonzalez LG, Saldarriaga NE, Bedoya M, Toro JM, Velasquez JB, Valencia JC, Arango CM, Aleman PH, Vasquez EM, Chavarriaga JC, Yepes A, Pulido W, Cadavid CA, Grupo de Investigacion ... some standards of care will be changed The Endocrine Society has already issued a statement [10], just after the publication of the results of NICE-SUGAR, advocating the need for more nuanced ... recommendations on glucose control Likewise, other official bodies (for instance, the Joint Commission on Accreditation of Healthcare Organizations, the Institute for Healthcare Improvement and the...

Ngày tải lên: 13/08/2014, 16:20

3 290 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is ... increasing the amount of data lost during a crash For this paper we will assume that crashes are infrequent and that it is acceptable to lose a few seconds or minutes of work in each crash; for applications ... reserved for this purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
reducing the degree or intensity of, or eliminating, pollution

reducing the degree or intensity of, or eliminating, pollution

... or fog The dry forms are acidic gases or particulates Acid Mine Drainage: Drainage of water from areas that have been mined for coal or other mineral ores The water has a low pH because of ... Pollutants may include almost any natural or artificial composition of airborne matter capable of being airborne They may be in the form of solid particles, liquid droplets, gases, or in combination thereof ... ng Asbestos Assessment: In the asbestos-in-schools program, the evaluation of the physical condition and potential for damage of all friable asbestos containing materials and thermal insulation...

Ngày tải lên: 24/04/2013, 14:40

217 423 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

... is refined latent heat of vaporization of water at the condenser surface of last stage (J/kg), h fgNs is latent heat of vaporization of water at the condenser surface of the last stage (J/kg), ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged ... taken as outlet temperature of the parallel combination Each flat plate collector has an area of 1.35m2 inclined at an angle equal to latitude of Chennai (13o) facing towards due south for the...

Ngày tải lên: 05/09/2013, 16:11

26 568 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language ... of the clause; and the Rheme is the remainder of the message The Theme may be a nominal group, an adverbial group, or a prepositional phrase The Theme may be single or multiple, marked or unmarked...

Ngày tải lên: 07/09/2013, 13:48

39 827 2
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material ... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... Sayer verbal said 27 Senser mental understand 28 Actor material working 29 Actor materialswitched on 30 Actor material work 31 Sayer verbal said 32 Goal material are stuck 33 Actor material take...

Ngày tải lên: 12/02/2014, 20:20

18 714 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... phosphate was released over that of PhyH-DII alone More phosphate (1.17– 2.49 fold) was also released after subsequent addition of PhyH-DI to a BPP (168PhyA or PhyP), or an HAP (E coli AppA) and ... of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

... the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation ... member of the Arab League of States, and a signatory of the Arab Transit Agreement of 1977 In terms of this agreement, ‘Palestine’ has the right of free transit over the territories of other Arab ... territory over 97 percent of the West Bank, Gaza and Jerusalem; with Arab East Jerusalem as the Capital of that state (including the holy place of the Haram al-Sharif, the Noble Sanctuary); with an...

Ngày tải lên: 16/02/2014, 11:20

64 307 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... using the Marquardt method for parameter optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of ... chosen as references because these are the most distant pair of haems in the structure and are therefore expected to have the weakest interaction [33] The pH dependence of the chemical shifts of the ... that the spectra are very similar with respect to chemical shifts of the signals in intermediate stages of oxidation, and that formation of the complex does not lead to a marked decrease of the...

Ngày tải lên: 19/02/2014, 17:20

10 640 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

... correlation of events For instance, an I/O Facade may depend on data from a subset of all Sensor Proxies Furthermore, it may use data from many Sensor Proxies in a single calculation of aircraft position ... hardware, such as Forward Looking Infrared Radar, requires a new Sensor Proxy, I/O Facades must be altered to take advantage of the new technology ample has the following participants: Aircraft ... Sensor Proxies If data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade...

Ngày tải lên: 19/02/2014, 18:20

20 738 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful ... to Dr T Yamazaki for NMR measurements, Y Yagi for the amino acid analysis, and Y Yoshimura for the sequence analysis REFERENCES Masaki, T., Nakamura, K., Isono, M & Soejima, M (1978) A new proteolytic...

Ngày tải lên: 21/02/2014, 03:20

7 603 0
Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

... there exists a very neat characterization of nef classes on arbitrary surfaces, K¨hler or not a The Main Theorem has an important application to the deformation theory of compact K¨hler manifolds, ... Annals of Mathematics, 159 (2004), 1247–1274 Numerical characterization of the K¨hler cone of a compact K¨hler manifold a a By Jean-Pierre Demailly and Mihai Paun Abstract The goal of this work ... important consequence is the fact that for an arbitrary deformation X → S of compact K¨hler manifolds, the a K¨hler cone of a very general fibre Xt is “independent” of t, i.e invariant by a parallel...

Ngày tải lên: 05/03/2014, 23:20

29 468 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... whether activated HP8Xa could hydrolyze the HP8 substrate Ile-Glu-Ala-Arg-p-nitroanilide (IEARpNA) [31] ProHP8Xa lacked IEARase activity, but after the zymogen was activated by factor Xa, IEARase ... used as template for quantitative RT-PCR analysis The M sexta ribosomal protein S3 (rpS3) mRNA was used as an internal standard to normalize the amount of RNA template The primer pairs used are ... To test the ability of HP8Xa to cleave proSpatzle, 25 ng of ¨ factor Xa-activated HP8Xa or 50 ng of factor Xa alone as a control was incubated with 100 ng of proSpatzle in the ¨ presence of 20...

Ngày tải lên: 06/03/2014, 09:22

15 541 0
w