the analysis of mouthwash by hplc a research experiment

Báo cáo hóa học: "Research Article The Problem of Scattering by a Mixture of Cracks and Obstacles" pptx

Báo cáo hóa học: "Research Article The Problem of Scattering by a Mixture of Cracks and Obstacles" pptx

... 10871080, Laboratory of Nonlinear Analysis of CCNU, COCDM of CCNU References R Kress, “Frechet differentiability of the far field operator for scattering from a crack,” Journal of Inverse and Ill-Posed ... to the situation when the boundary or more generally a portion of the boundary is coated with an unknown material in order to avoid detection Assuming that the electric field is polarized in the ... of the first kind of order zero By making use of the known jump relationships of the single- and double-layer potentials across the boundary ∂Ω see 5, 11 and approaching the boundary ∂Ω from inside...

Ngày tải lên: 21/06/2014, 20:20

19 271 0
Báo cáo hóa học: " Research Article Optimum Detection of Ultrasonic Echoes Applied to the Analysis of the First Layer of a Restored Dome" pot

Báo cáo hóa học: " Research Article Optimum Detection of Ultrasonic Echoes Applied to the Analysis of the First Layer of a Restored Dome" pot

... areas where modifications had been made to the surface (a special type of paper was attached to the wall after preparation of the paintings) This a ected the transducer-wall coupling in such a ... know a priori that the mortar layer is always present in the scale model of the dome In consequence, the normalized mean (last column in Table 1) may be a valuable figure of merit to evaluate the ... give an adequate balance between resolution and the capacity to penetrate into the mortar It should be noted that mortar is a material composed of sand and cement paste Two essential parts of its...

Ngày tải lên: 22/06/2014, 19:20

10 386 0
Students’ Attitudes Towards the Teaching of Speaking by Native-English-Speaking Teachers  A Survey Research at Thai Binh Teacher Training College

Students’ Attitudes Towards the Teaching of Speaking by Native-English-Speaking Teachers A Survey Research at Thai Binh Teacher Training College

... general and the improvement of the teaching of speaking in particular and other areas of English language teaching in general by non-native teachers Aims of the Study and Research Questions The aims ... relevant to the task of learning a second language than others Another way of classifying attitude variables is either educational or social attitudes Instances of educational attitudes would be attitudes ... countries, and their informal and flexible teaching styles Sekigawa et al, (2003) also studies advantages and disadvantages of having native speakers as teachers of English and clarifies that the majority...

Ngày tải lên: 19/03/2015, 10:28

56 848 0
A thesis submitted to the university of huddersfield in fulfilment of the requirements for the degree of MA by research

A thesis submitted to the university of huddersfield in fulfilment of the requirements for the degree of MA by research

... who had completed the language appraisal at the beginning of the academic year were approaching the end of their taught classes The interviews centred on a theme of reflection upon the academic ... from Language Appraisal September 2011 In my language appraisal last year I wrote that a lot of people are afraid of speaking English because it‘s not our first language People are afraid of making ... process and change over time An interest in the self and representations of the self An awareness that the researcher him -or herself is also a narrator These outlines of the approach portray a profound...

Ngày tải lên: 26/09/2015, 11:58

89 450 0
A bourdieuvian analysis of the use of singlish by youths in singapore

A bourdieuvian analysis of the use of singlish by youths in singapore

... language, a language of education, a working language, a lingua franca, (a language for) the expression of national identity and an international language” (p.74) The paramount concern of the government ... 2002:281) In the Singaporean context, the government’s emphasis on the mastery of the standard variety of English as a means towards maximising competitive advantage is clearly a case of language commodification ... comprehensive than the diglossia framework because it examines variation both along a cline of proficiency as well as of formality An even more recent approach to the analysis of Singapore English is the...

Ngày tải lên: 16/10/2015, 15:35

126 912 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... significantly different cold-acclimation capacities, we prove that mathematical modelling of metabolism and validation by experimental data offers an attractive possibility for the study of complex ... T, Sawodny O, Ederer M & Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase ... Experimental procedures, the rate of assimilate export from photosynthetically active source organs to consuming sink organs or metabolic pathways other than carbohydrate pathways was calculated as the...

Ngày tải lên: 14/02/2014, 22:20

13 707 0
Tài liệu A Manual of the Operations of Surgery, by Joseph Bell doc

Tài liệu A Manual of the Operations of Surgery, by Joseph Bell doc

... Ligature of Innominate Ligature of third part of Left Subclavian Ligature of Axillary in its first part 10 Ligature of Axillary in its third part 11 Ligature of Brachial 12 Amputation of Arm by ... Ligature of Arteries— General Maxims —Ligature of Aorta—Iliacs— Gluteal— Femoral— Popliteal— Innominate— Carotids— Lingual— Subclavian— Brachial, etc., 1-45 CHAPTER II AMPUTATIONS Eras of Amputation— ... Operations on Air Passages, 241 XXXII Diagram illustrating Operations for Hernia, 253 XXXIII Diagram of an Artificial Anus, 257 XXXIV Diagram of Section of Prostate, 259 XXXV Diagram of Membranous...

Ngày tải lên: 17/02/2014, 07:20

1K 1.3K 0
TECHNIQUES FOR THE ANALYSIS OF ORGANIC CHEMECALS BY INDUCTIVELY COUPLED PLASMA MASS SPECTROMETRY (ICP-MS) pptx

TECHNIQUES FOR THE ANALYSIS OF ORGANIC CHEMECALS BY INDUCTIVELY COUPLED PLASMA MASS SPECTROMETRY (ICP-MS) pptx

... the plasma A default flow of oxygen is added to the carrier gas flow (e.g Oxygen at 5% of the total argon carrier flow) and the organic solvent is aspirated at an appropriate flow rate The oxygen ... solution into the spray chamber by self-aspiration The spray chamber and plasma torch are made of highpurity quartz and any seals in the sample introduction and drain systems are replaced with solvent ... involves the use of a lower sample flow rate, a chilled spray chamber (-2oC), oxygen addition at approximately 5% (Table 1) and an ICP torch designed to maintain a stable plasma with organics Many other...

Ngày tải lên: 05/03/2014, 21:20

6 610 0
The Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report pot

The Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report pot

... uncertainty analyses and make available a presentation of the uncertainty analysis that would be clear and transparent to decisionmakers and to other interested readers Analysis of benefits for EPA ... Air Quality Planning and Standards www.epa.gov/ttn/ecas/regdata/RIAs/finalpbria.pdf ——— 200 9a Proposed NO2 NAAQS Regulatory Impact Analysis (RIA) Research Triangle Park, NC: Office of Air Quality ... 6-8; Keohane 2009, 45-47 The NAAQS establish ambient standards for key air pollutants and are the flagship rules of the Clean Air Act (CAA) While the CAA prohibits the consideration of cost in...

Ngày tải lên: 06/03/2014, 19:20

24 427 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx

A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx

... influence the way in which people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the ... (RRA) approach to initial project preparation was developed By the end of the decade, there was a range of RRA methods and approaches available which then gave rise to participatory rural appraisal ... interviews Rapid market appraisal The origins of rapid market appraisal (RMA) are similar to those of rapid rural appraisal (RRA), in that formal surveys were often seen as lengthy, costly and management...

Ngày tải lên: 07/03/2014, 00:20

95 645 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

... to wait It was not until the latter part of March that the Duke of Carmona came back to his mother's villa at Biarritz His arrival was not announced in the local paper, nevertheless I heard of ... shrunk away in fear if she had known that she was talking with the Marqués de Casa Triana I, in my character of Trevenna, found out that the Princess had a friend, Lady Monica Vale, daughter of the ... already heard all about the King's automobile, and was primed with particulars He leaned across to describe its appearance, as well as mention the make; and when such a car as he was in the act...

Ngày tải lên: 07/03/2014, 11:20

424 1.3K 0
Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

... preferential attachment can be interpreted as the tendency of a language to choose a consonant that has been already chosen by a 131 not all of the first 21 consonants Therefore, the probability of the ... us assume that the inventory of all the languages comprises of 21 consonants We further assume that the consonants are arranged in their hierarchy of preference A language traverses the hierarchy ... A L Barab´ si 2000 The large-scale organization of a metabolic networks Nature, 406:651-654 R Jakobson and M Halle 1956 Fundamentals of Language, The Hague: Mouton and Co P Ladefoged and I Maddieson...

Ngày tải lên: 08/03/2014, 02:21

8 550 0
Research " CULTURE AND THE EFECTIVENESS OF SUPPLIER DIVERSITY PROGRAMS: A TEST OF PREDICTORS " doc

Research " CULTURE AND THE EFECTIVENESS OF SUPPLIER DIVERSITY PROGRAMS: A TEST OF PREDICTORS " doc

... was analyzed using factor analysis and clustering Both sets of data were then included in a partially-ordered meta-matrix for further analysis Sample A list of buying units was obtained from the ... a variety of sources to collect data as well as quantitative and qualitative methods for analyzing the data The data on effectiveness of supplier diversity was categorized using deductive analysis ... great deal of consensus along these measures, these shared behavioral norms demonstrate a strong organizational culture and a defined pattern of underlying values and ways of seeing things (Sathe...

Ngày tải lên: 16/03/2014, 03:20

84 344 0
Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt

Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt

... points was collected The spectrum was calibrated using a dataset of a sample of standard peptides After calibration, the masses of the standard peptides differed by maximum 1.1 p.p.m from the theoretical ... 2.2 A The cathode surface potential was )1 V and the anode potential was 10 V Both end-plate potentials of the ion trap were set at 1.5 V and the duration of the electron pulse was 100 ms Data acquisition ... pain and discomfort for the mice, which were maintained in accordance with the National Institutes of Health Guide for the care and use of Laboratory Animals All experiments were approved by the...

Ngày tải lên: 17/03/2014, 10:20

7 491 0
The Romance Of Antar By Anonymous, Terrick Hamilton, W. A. Clouston doc

The Romance Of Antar By Anonymous, Terrick Hamilton, W. A. Clouston doc

... same father, and the same mother; he is the eldest and I am the youngest; and our father was one of the Arab chieftains, and he was called Amru, the son of Harith, the son of Teba; and Teba was ... 32 The Romance of Antar BATTLE OF THE TRIBES OF ABS AND TEY—ANTAR TO THE RESCUE! The Absians meet the Teyans, and are defeated; their bravest warriors retreat, and the women of Abs are taken captive ... wedding among a friendly tribe Antar had the honour of escorting a party of Absian women of rank, among whom was the fair Abla, with their attendants On the way thither some brigands attack them,...

Ngày tải lên: 23/03/2014, 12:20

159 390 0
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

... structural data are available MATERIALS AND METHODS Building the 3D model of PMA1_NEUCR In our approach, the model of PMA1_NEUCR was built using the ATC1_RABIT crystal structure as template by combining ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol ... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to the...

Ngày tải lên: 23/03/2014, 21:20

13 514 0
Báo cáo khoa học: "A SITUATION SEMANTICS APPROACH TO THE ANALYSIS OF SPEECH ACTS" ppt

Báo cáo khoa học: "A SITUATION SEMANTICS APPROACH TO THE ANALYSIS OF SPEECH ACTS" ppt

... into a formal, and in particular, a computational analysis of d i s c o u ~ ? The natural alternative to a syntactic definition is a semantic one and the approach to se,manties which offers the ... st - and can be regarded as representing the Iocutionary aspect of the act The other gives the set of situation-types of the diseoursc situation (including author and reader or speaker and addressee) ... initial creation of the situation-type (the first clause), the interpretation of but and the modification of the initial situation-type to accommodate the information in the second clause SPEECH ACTS...

Ngày tải lên: 24/03/2014, 01:21

4 489 0
báo cáo hóa học: " Discrimination and reliability: equal partners? Understanding the role of discriminative instruments in HRQoL research: can Ferguson''''s Delta help? A response" pptx

báo cáo hóa học: " Discrimination and reliability: equal partners? Understanding the role of discriminative instruments in HRQoL research: can Ferguson''''s Delta help? A response" pptx

... people in a meaningful way This would invalidate any statistical treatment of data that failed to take measurement error into account It does not constitute an argument against the use of Delta It ... Delta is derived from ordinal comparisons of persons that classify them as either the same or different Therefore, if a researcher doubts that an instrument can be trusted to make this most basic ... reliability for the task at hand; they should provide interpretable data; and thus any discriminations made should be 'real' My argument is that the degree to which a discriminative instrument actually...

Ngày tải lên: 18/06/2014, 19:20

3 384 0
Báo cáo hóa học: " Characterizing the burden of premature ejaculation from a patient and partner perspective: a multi-country qualitative analysis" docx

Báo cáo hóa học: " Characterizing the burden of premature ejaculation from a patient and partner perspective: a multi-country qualitative analysis" docx

... in the native language and were simultaneously transcribed into English Analysis The objective of the analysis was to review the qualitative data to characterize the functional, emotional, and ... or rooted based on examination of the data and not initially imposed on the data The research team, which included five health services researchers, used Ethnograph qualitative data analysis http://www.hqlo.com/content/6/1/33 ... understanding the impact of PE from the perspective of males with PE and of female partners of men with PE A key strength of this qualitative research study is the large number of male and female participants...

Ngày tải lên: 18/06/2014, 22:20

10 514 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...

Ngày tải lên: 18/06/2014, 22:20

5 483 0
Xem thêm
w