the account shall be credited generally with a debit to account 129

The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx

The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx

Ngày tải lên : 28/06/2014, 19:20
... day was signalised by the apparition of the sun, the stars, the moon, and the planets; that, on the fifth day, aquatic animals originated within the waters; that, on the sixth day, the earth gave ... He may have been actuated by malice It has constantly happened that even an accurate man has declared that a thing has happened in this, that, or the other way, when a careful analysis of the ... the space of six natural days, in such a manner that, on the first of these days, light appeared; that, on the second, the firmament, or sky, separated the waters above, from the waters beneath...
  • 330
  • 324
  • 0
Báo cáo toán học: "Asymptotics of the average height of 2–watermelons with a wall" pps

Báo cáo toán học: "Asymptotics of the average height of 2–watermelons with a wall" pps

Ngày tải lên : 07/08/2014, 15:23
... the representations of the constants ca,b by certain integrals (see (50) in appendix A. 3), we obtain the following approximative asymptotics by numerical integration (carried out with Mathematica) ... this paper is to work out the exact asymptotics for the simple special case p = by imitating the classical reasoning of de Bruijn, Knuth and Rice [6] for the case p = (i.e., for the average height ... Inserting the information from (27) in (26) shows that all the log(n)–terms cancel, as well as all evaluations of the digamma function ψ (see appendix A. 2.1) So we the electronic journal of combinatorics...
  • 20
  • 319
  • 0
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx

Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx

Ngày tải lên : 10/08/2014, 23:21
... type hamartomatous polyp Case was a hamartomatous polyp with a focus of well-differentiated adenocarcinoma, and Case was a hamartomatous polyp with Table Twenty-seven cases of solitary duodenal Peutz-Jeghers ... differ in the malignant alteration of a hamartomatous polyp and concomitant other cancers Patients with duodenal Peutz-Jeghers type hamartomatous polyps should undergo colonoscopy and whole-body ... data YS, HT, TK, CT, YA, AN and SM performed the histological examination of the organs YS, MI and SK were major contributors in writing the manuscript All authors read and approved the final...
  • 4
  • 458
  • 0
Báo cáo khoa học: "The impact of empiric antimicrobial therapy with a β-lactam and fluoroquinolone on mortality for patients hospitalized with severe pneumonia" pptx

Báo cáo khoa học: "The impact of empiric antimicrobial therapy with a β-lactam and fluoroquinolone on mortality for patients hospitalized with severe pneumonia" pptx

Ngày tải lên : 12/08/2014, 23:20
... Department of Health and the Department of Veteran Affairs clinical database Mortality status was assessed up to the end of December 2002 Antimicrobial therapy We obtained information on all antimicrobial ... study, the analysis of the data, and preparation of the paper All authors read and approved the final manuscript Acknowledgements EMM was supported by a Department of Veterans Affairs Veterans Integrated ... Marco MA, Torres A, Mensa J: Addition of a macrolide to a beta-lactam-based empirical antibiotic regimen is associated with lower in-hospital mortality for patients with bacteremic pneumococcal...
  • 8
  • 347
  • 0
Báo cáo y học: " And the second shall be first" ppsx

Báo cáo y học: " And the second shall be first" ppsx

Ngày tải lên : 14/08/2014, 17:22
... in Nature and one in Cell”, as if that fact alone is all that needs to be said about the quality of the applicant Frequently, stating where the papers were published is a surrogate for actually ... felt the need to beat their competitors and to have their work published in a journal with as high a profile as possible I think that feeling is often self-defeating, as it clearly was here The ... incomplete, hasty in its judgments, and not nearly as informative as the second paper, which has the advantage not only of calmer consideration, but also has the first paper to use for target practice...
  • 3
  • 209
  • 0
Designing a supplementary reading syllabus with a view to improving reading skills for the first-year English majors at Hai Phong Private University

Designing a supplementary reading syllabus with a view to improving reading skills for the first-year English majors at Hai Phong Private University

Ngày tải lên : 19/03/2015, 10:28
... of the syllabus, the advantages and disadvantages of each syllabus type, the background of the target learners as well as the teaching situation at HPU and the survey results, the author has ... former approaches above because it fully takes the learner into consideration The learner factor is always paid full attention at every stage of the learning process This means that the learner plays ... motivate learners‟ study more than other skills because it is much easier and can be done at any time, anywhere with a lot of available materials The main purpose of any reading program is to enable...
  • 83
  • 993
  • 1
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus

The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus

Ngày tải lên : 19/11/2015, 15:51
... (Puma concolor), the jaguar (Panthera onca), the ocelot (Leopardus pardalis) the tayra (Eira barbara), the collared peccary (Pecari tajacu), and the northern viscacha (Lagidium peruanum) The ... Southern part of the Region Amazonas, in Chacanto, Region Cajamarca and in various localities in the Region La Libertad (San Vicente/Pusac, Santa Rosa/El Tingo, Vijus, Chagual, Calemar, and Pias) at ... the Region Cajamarca A: La Balza; B: Bellavista; C: Jaen/Gota de Agua; D: Perico; E: Pucara; F: Santa Rosa de la Yunga; G: Chacanto; H: Limon 26 BIODIVERSITY OF THE PERUVIAN DRY FOREST HERPETOFAUNA...
  • 264
  • 492
  • 0
Tài liệu Updating a DataSet with a Many-to-Many Relationship ppt

Tài liệu Updating a DataSet with a Many-to-Many Relationship ppt

Ngày tải lên : 26/01/2014, 10:20
... update the changes made to the DataSet with the data source Refresh Button.Click This event handler clears all data from the DataSet LoadData( ) is then called to load all data from the data source ... each The LoadData( ) method is called to retrieve data for each table in the DataSet Finally, the default view for the parent and the child tables are bound to data grids on the form LoadData( ... random data to the DataSet Modify Button.Click This event handler makes random changes to the data in the DataSet: • • • • Rows from the parent and child table are deleted or have values in their...
  • 19
  • 304
  • 0
The Marginal External Cost of Car - with an Application to Belgium - potx

The Marginal External Cost of Car - with an Application to Belgium - potx

Ngày tải lên : 07/03/2014, 11:20
... that the marginal to average accident rate ratio equals Marginal accident externalities are then BF 1.1 in the case of urban and 'other' roads and BF 0.4 on highways In case a marginal to average ... a later section of this paper The other marginal cost categories can be considered as external Together with the external part of the marginal accident costs they constitute the total marginal ... empirical exercise, FIGURE presents the total marginal externality if the additional car-km is driven by an average car of 1989 and under the assumption that the marginal to average accident rate ratio...
  • 34
  • 522
  • 0
cruising the mexican riviera and baja [electronic resource]  a guide to the ships and the ports of call.

cruising the mexican riviera and baja [electronic resource] a guide to the ships and the ports of call.

Ngày tải lên : 29/05/2014, 15:16
... factors that bring the region’s heavy summer and early autumn rainfall The Mexican Riviera Port of Call USA Durango MAZATLAN N C A M E X I San Blas Tepic Aguacaliente Puerto Vallarta GUADALAJARA ... main theater, as Carnival Paradise well as many colorful bars and lounges concentrated on the Promenade Deck The piano bar adjacent to the aft lounge is a beautiful spot to relax As far as other ... immediately behind the many bays that dot the Mexican Riviera These are the Sierra Madre Occidental in the northern part of the Riviera and the Sierra Madre del Sur, beginning around Manzanillo The...
  • 295
  • 831
  • 0
MicroRNA expressions in the MPTP induced parkinsons disease model with special reference to mir 124

MicroRNA expressions in the MPTP induced parkinsons disease model with special reference to mir 124

Ngày tải lên : 10/09/2015, 09:12
...  Nandhini Kanagaraj, Yawata M, He Beiping, S Thameem Dheen, Samuel, Sam Wah Tay Dysregulated microRNA and mRNA networks in the substantia nigra of MPTP-treated mice (Manuscript under preparation) ... gamma-aminobutyric acid b receptor gamma-aminobutyric acid b receptor cyclin G associated kinase glucosidase, beta, acid glutamine-fructose-6-phosphate transaminase glycoprotein (transmembrane) ... concentrated efforts towards identifying the causes of PD, there is no single cause known to lead to the development of PD It remains a multifactorial disease with several causative factors and many...
  • 254
  • 337
  • 0
The Secret Adversary AGATHA CHRISTIE CHAPTER 6 A Plan of Campaign A veil might with profit be docx

The Secret Adversary AGATHA CHRISTIE CHAPTER 6 A Plan of Campaign A veil might with profit be docx

Ngày tải lên : 05/07/2014, 18:20
... Wheeler, 43 Clapington Road, Battersea She's a lady's maid, as far as I remember, so probably won't be there, and, anyway, she's not likely." "Then the Mayfair lady is clearly indicated as the first ... of a front garden Tommy paid off the taxi, and accompanied Tuppence to the front door bell As she was about to ring it, he arrested her hand "What are you going to say?" "What am I going to say? ... logical manner That man, Danvers, was shadowed on the way over, wasn't he? And it's more likely to have been a woman than a man " "I don't see that at all." "I am absolutely certain that it...
  • 13
  • 223
  • 0
Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt

Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt

Ngày tải lên : 13/08/2014, 14:20
... First, each of the independent variables was tested against each of the outcome variables by Fisher’s exact test or regression analysis with one explanatory variable Thereafter, the variables that ... significant (Tables and 4) Is there an association between the diagnostic classification and the course pattern of LBP or total number of LBP days? The diagnostic classes were associated with both the ... diagnostic class, statistical testing in relation to agreement was unworkable and the agreement was therefore only evaluated in percentages that not take into account agreement by chance The agreement...
  • 8
  • 293
  • 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

Ngày tải lên : 14/08/2014, 19:22
... were as follows: EGFR gene forward primer, 5' -CGAGGGCAAATACAGCTTTG -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters ... Vaccines and Therapy 2005, 3:5 according to the recommendation of the manufacturer (Dharmacon Research, USA) [19] The following sequences were successfully made: siRNA-EGFR sense 5'GGAGCUGCCCAUGAGAAAUdTdT-3' ... deliver the gene(s) to cancer cells, and hoped that the transgene would be translated into a protein to provide a therapeutic effect However, clinical trials have shown that the therapeutic outcome...
  • 12
  • 314
  • 0
LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN

LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN

Ngày tải lên : 22/10/2014, 20:00
... HOW TO TELL THE SEX OF A BIRD THIS IS AMAZING !!! Until now I never fully understood how to tell the difference between Male and Female birds I always thought it had to be determined surgically ... Until now Below are two birds Study them closely See if you can spot which of the two is the Female It can be done Even by one with limited bird watching skills…! Send this to all of the men you ... bird watching skills…! Send this to all of the men you know, who could with a good laugh, and to all women who have a great sense of humor !!! Collection by FGMLGMU 06/03/2011 ...
  • 4
  • 465
  • 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21
... Medical Research Council of Australia, the Australian Research Council, the National Heart Foundation of Australia (to RNP and AMB), Research Grants HL-06350 and HL-32656 from the National Institutes ... affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin – Heparin Heparin ⁄ calcium 4 2 4 1 3 Factor Xa HCII ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases,...
  • 10
  • 668
  • 0
The World with a Thousand Moons pdf

The World with a Thousand Moons pdf

Ngày tải lên : 06/03/2014, 00:20
... Her face was still very pale Kenniston, standing tense, had had an idea A desperate chance to make a break, in the face of Murdock's atom-gun The captain had said that he had just ordered the ... rocket-tubes that had softened the impact of their fall But the wrecked Falcon had been marooned there in the weird asteroidal jungle, with the alien, menacing Vestans already gathering around it The ... for gravitation-paralysis." Captain Walls, himself an old-time space-man, was first of the group to appreciate the significance of the statement The captain gasped "A preventative for gravitation-paralysis?...
  • 52
  • 408
  • 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Ngày tải lên : 06/03/2014, 01:20
... primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and ... Samples were taken from the cultures before induction and at harvest The total RNA from the bacteria was purified using RNeasy Protect Bacteria Mini Kit (Qiagen) Two separate cDNA synthesis reactions...
  • 11
  • 445
  • 0