terminology convertibility and correlation with laboratory changes in chronic hepatitis c
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx
Ngày tải lên :
10/08/2014, 10:20
... http://www.cardiothoracicsurgery.org/content/4/1/33 Figure survival according presence of complete/incomplete capsula Overall Overall survival according presence of complete/incomplete capsula In this ... extent of macroscopic or microscopic invasion in mediastinal structures The clinical stage was thus determined by critical review of surgical records and pathology reports Further more, R-, Nand M-Status ... aggressiveness and went confirm with Masaoka staging and clinical outcome not being of prognostic independence An encapsulated tumor presented a better clinical outcome than loss of a pseudocapsula...
- 10
- 355
- 0
Báo cáo y học: " Predictors and correlates for weight changes in patients co-treated with olanzapine and weight mitigating agents; a post-hoc analysis" docx
Ngày tải lên :
11/08/2014, 16:23
... Our finding of a decrease in cognitive restraint (the cognitive control of eating) as a significant predictor for weight gain is especially interesting considering the findings of Khazaal and colleagues, ... modifications resulting in reduced caloric intake and enhanced physical activity are helpful in minimizing weight gain during treatment with olanzapine in patients susceptible to weight gain, [8] ... non-significant [11,12] and might explain the modest effects seen in the analysis conducted by the Cochrane Group [9] In contrast, we defined categorical outcomes that constitute clinically significant...
- 11
- 497
- 0
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx
Ngày tải lên :
11/08/2014, 21:21
... Predictors of the efficacy of interferon therapy in chronic hepatitis C virus infection Tokyo-Chiba Hepatitis Research Group 1997, 113:558-66 Kaufman RJ: The Double-stranded RNA-activated Protein ... acids in sustained responders [11] In our local 3a strains, substitutions in rapid responder were found in hydrophilic amino acid histidine which was replaced by a neutral amino acid glutamine ... polar amino acids in all samples Among polar amino acids positively charged amino acids were greater than negatively charged amino acid thus making it a basic stretch that might be involved in interacting...
- 5
- 254
- 0
Báo cáo y học: "Enhanced late-outgrowth circulating endothelial progenitor cell levels in rheumatoid arthritis and correlation with disease activity" doc
Ngày tải lên :
12/08/2014, 11:23
... hemangioblastic, within the circulating blood, and two distinct cell types of EPCs are currently recognized according to their growth characteristics and morphological appearance: early-outgrowth EPCs and ... negative controls Third, viable PBMCs were discriminated by 7-aminoactinomycin D (7AAD) labelling The EPC and CEC populations were finally identified as Lin-/7AAD-/CD34+/CD133+/VEGFR-2+ cells and Lin-/ ... the detachment of mature CECs and vascular hurting [33] We concomitantly determined the value of CECs as compared with EPCs We found a correlation in RA between these two circulating cell levels...
- 8
- 252
- 0
Báo cáo y học: "Circulating retinol binding protein 4 in critically ill patients before specific treatment: prognostic impact and correlation with organ function, metabolism and inflammation" pot
Ngày tải lên :
13/08/2014, 21:21
... vitamin A and their binding proteins following acute stress Clin Endocrinol (Oxf) 1978, 8:109-122 doi:10.1186/cc9285 Cite this article as: Koch et al.: Circulating retinol binding protein in critically ... Weiskirchen R, Gressner AM, Trautwein C, Tacke F: Insulin resistance in liver cirrhosis is not associated with circulating retinolbinding protein Diabetes Care 2007, 30:1168-1172 19 Tacke F, ... Yagmur E, Trautwein C, Gressner AM, Tacke F: Resistin serum levels are associated with insulin resistance, disease severity, clinical complications, and prognosis in patients with chronic liver diseases...
- 11
- 216
- 0
Magnetic resonance spectroscopy correlation with histological analysis in gliomas and structure determination of a hypothetical protein
Ngày tải lên :
10/11/2015, 11:35
... 29 Compound Structure formula Proton number TSP (CH3)3SiCD2CD2CO2Na HO Lactate O H 3C NAA NH O O O- HC C H 3C C H H2 C C C H COOH O COO- Ala H 3C C H NH3+ CH3 H2N Cr C H2 C N COOH HN H3 C Cho H2 C ... phenomena, including reaction kinetics and intra-molecular dynamics of macromolecules Additionally, NMR is efficient in determining ligand binding and mapping interaction surfaces of protein/ligand complexes ... Isoleucine CH3 15.8 1.00 Isoleucine CH3 12.2 0.92 CH 72.1 3.55 Lactate CH 69.5 4.12 Lactate CH3 21.3 1.32 Leucine 55.3 3.75 Myo-inositol CH 22 Leucine CH2 41.0 1.71 Leucine CH 25.3 1.71 Leucine CH3...
- 92
- 284
- 0
Báo cáo khoa học: "HUMAN INTENTION-BASED SEGMENTATION: RELIABILITY AND CORRELATION WITH LINGUISTIC CUES" doc
Ngày tải lên :
08/03/2014, 07:20
... such empirical work is to use the results to correlate linguistic cues with discourse structure By asking subjects to segment discourse using a non-linguistic criterion, the correlation of linguistic ... referential link if its index occurs anywhere in the current segment Any other NP type provides a referential link if its index occurs in the immediately preceding FIC The symbol NP in Figure indicates ... Discourse Academic Press, London C Linde 1979 Focus of attention and the choice of pronouns in discourse In T Givon, editor, Syntax and Semantics: Discourse and Syntax, pages 337354 Academic Press,...
- 8
- 224
- 0
Báo cáo khoa học: Crystal structures of HIV protease V82A and L90M mutants reveal changes in the indinavir-binding site potx
Ngày tải lên :
23/03/2014, 12:20
... main chain atoms of residues 81–82, and PRL90M also had changes in the conformation of the catalytic aspartates, probably associated with the close contact of Met90, and in the side chains interacting ... further from indinavir compared to PR, the Cc of P81 has maintained similar van der Waals ˚ contacts with C1 9 of indinavir (3.8 and 3.9 A in PR and PRL90M, respectively) (Fig 6B) The closest Cc atom ... Waals contacts, ˚ with interatomic distances of < 4.0 A for the major conformation of the side chains and 98 contacts for the minor conformations PRV82A showed 95 van der Waals contacts with indinavir,...
- 9
- 355
- 0
Báo cáo hóa học: " Immune and hemorheological changes in Chronic Fatigue Syndrome" pdf
Ngày tải lên :
18/06/2014, 16:20
... statistical significance the chemokine receptor (CCR7) and higher levels of chemokine receptor (CXCR) in response to chemokines CCL19, CCL21 and CXCL10, CXCL11 respectively [27,28] These chemokines ... chemokine receptor function affected the CD56 bright CD16 - NK migration to the periphery Interestingly, activated CD56 bright CD16 - NK cells also produce chemokines CXCL8, CCL4, CCL5 and CCL22 ... apoptosis-inducing ligand (TRAIL) on NK cells thus activating caspase and inducing cytotoxic activity [39] CD56bright CD16- NK cells are therefore important for NK cytotoxic activity and a correlation...
- 10
- 470
- 0
báo cáo hóa học: " Identification of symptom domains in ulcerative colitis that occur frequently during flares and are responsive to changes in disease activity" ppt
Ngày tải lên :
18/06/2014, 19:20
... interleukin 12, interleukin 17, and endothelial integrins The efficacy of UC therapies in clinical trials is assessed with disease activity indices that typically combine clinical symptoms, physician ... year cumulative colectomy rate [5,6] Many potential new therapies for ulcerative colitis are currently being developed in preclinical testing and clinical trials, including molecules targeting interleukin ... were included from commonly used indices of ulcerative colitis disease activity (Truelove and Witts, St Mark's Index, CAI, SCCAI, UCSS, Mayo, and UCDAI), and twelve novel symptom domains were included...
- 12
- 382
- 1
Báo cáo lâm nghiệp: "Effects of drainage treatment and stand growth on changes in runoff components from a forested watershed" pps
Ngày tải lên :
07/08/2014, 03:22
... data caused by recording equipment, road-construction disturbance including drainage treatments, land-use management within the watershed and climate) (Šír et al 2004) The data collected during ... half-years (with distinct inflection points on the hydrograph falling limb and without excessive fluctuation caused by marginal precipitation events) to separate the runoff components In particular, ... after drainage network reconstruction Besides, the influence of growing up spruce thicket was also taken into account, because both the drainage system reconstruction and the forest stand regeneration...
- 7
- 403
- 0
Báo cáo khoa học: "Clinical efficacy and problems with CT lymphography in identifying the sentinel node in breast cancer" docx
Ngày tải lên :
09/08/2014, 07:21
... De Cicco C, Chinol M, Paganelli G: Intraoperative localization of the sentinel node in breast cancer: technical aspects of lymphoscintigraphic methods Semin Surg Oncol 1998, 15:268-271 Duncan ... breast cancer patients by CTLG and a dye-guided method since February 2003 as a clinical trial [5] Here, we report our findings to date regarding the clinical efficacy and problems associated with ... identification rates and the clinicopathological findings The results were analyzed in relation to the success/failure of SN identification and various clinicopathological parameters, including the patient...
- 6
- 290
- 0
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx
Ngày tải lên :
09/08/2014, 08:23
... OCN Sense ggtgcagcctttgtgtccaagc Antisense GTCAGCCAACTCGTCACAGTCC OPN Sense AGCCGTGGGAAGGACAGTTATG Antisense GAGTTTCCATGAAGCCACAAAC IGF-I Sense GAGCCTGCGCAATGGAATAAAG Antisense CCTGTCTCCACACACGAACTG ... CCTGTCTCCACACACGAACTG IGF-II Sense GAGGAGTGCTGTTTCCGCAG Antisense ACGTTTGGCCTCCCTGAACG TGF-β1 [53] Sense CTAGACCCTTTCTCCTCCAGGAGACG Antisense GCTGGGGGTCTCCCGGCAAAAGGT COL1A1 Sense CGGCAAGGTGTTGTGCGATG Antisense ... Antisense CACGGAAATTCCTCCGGTTG COL1A2 Sense CGCTGGTGAAGTTGGCAAACCA Antisense GAGGACCACGAAGCCCTTCTTTC GAPDH [16] Sense CATGGAGAAGGCTGGGGCTC Antisense CACTGACACGTTGGCAGTGG ALP, alkaline phosphatase; COL1A,...
- 12
- 421
- 0
Báo cáo y học: "Markers of B-lymphocyte activation are elevated in patients with early rheumatoid arthritis and correlated with disease activity in the ESPOIR cohort" pdf
Ngày tải lên :
09/08/2014, 14:22
... (0.66–1.60) TT versus CT and CC NS 0.94 (0.56–1.60) TT versus CT and CC Comparisons used chi-square test BAFF, B-cell activating factor of the tumor necrosis factor family; CI, confidence interval; NS, ... described in mucosa [30] In regard to the cytokine triggers of IgA increase, transforming growth factor-beta, which enhances IgA class switching [31], might be involved T cellindependent class IgA class ... of B-cell activation was associated with a specific clinical, immunological, or radiological pattern in patients with early RA The initial DAS28 was slightly but significantly correlated with...
- 8
- 399
- 0
Báo cáo y học: "Treatment of hypertriglyceridemia and HIV: fenofibrate-induced changes in the expression of chemokine genes in circulating leukocytes" ppsx
Ngày tải lên :
10/08/2014, 05:21
... Atherosclerosis in patients infected with HIV is influenced by a mutant monocyte chemoattractant protein-1 allele Circulation 2004, 110:2204-2209 Hadigan C, Meigs JB, Corcoran C, Rietschel P, Piecuch S, ... presumably increasing SDF-1 values SDF-1 plays a significant role in HIV infection because it is the natural ligand for CXCR4 which is used by HIV Ttropic strains to enter into the cells in advanced ... selected chemokine genes in whole blood We found that with respect to untreated patients there was no change in the expression of chemokine receptors CX3CR1 and CXCR4 but the expression of CCR2...
- 4
- 375
- 0
Báo cáo y học: "Unusual association of ST-T abnormalities, myocarditis and cardiomyopathy with H1N1 influenza in pregnancy: two case reports and review of the literature" pps
Ngày tải lên :
10/08/2014, 23:22
... importance in the setting of the H N 2009 swine-origin influenza pandemic [22] Inactivated influenza vaccine can be safely and effectively administered during any trimester of pregnancy No study ... the factors reducing the efficiency of T helper cells thus increasing the risk of mortality from influenza [8] Murine studies indicate that the acute cardiac injury is related to cytotoxic immunologic ... left ventricular function Discussion Uncomplicated human influenza virus infection causes transient tracheobronchitis, corresponding with predominant virus attachment to tracheal and bronchial epithelial...
- 5
- 418
- 0
Báo cáo y học: "The inverse association of serum HBV DNA level with HDL and adiponectin in chronic hepatitis B infection" ppt
Ngày tải lên :
12/08/2014, 01:21
... Tsamandas AC, Labropoulou-Karatza C: Serum adiponectin in chronic hepatitis C and B J Viral Hepat 2007, 14:577-583 10 Su TC, Lee YT, Cheng TJ, Chien HP, Wang JD: Chronic hepatitis B virus infection and ... Leung N, Lo CM, Fan ST, et al: Serum adiponectin is increased in advancing liver fibrosis and declines with reduction in fibrosis in chronic hepatitis B J Hepatol 2007, 47:191-202 30 Ettinger WH, ... nonspecific innate immunity Changes including altered HDL content and HDL apolipoprotein composition might redirect cholesterol from the liver to immune cells during infection [5,20] Regarding...
- 6
- 320
- 0
Dynamic and Mobile GIS: Investigating Changes in Space and Time - Chapter 1 potx
Ngày tải lên :
12/08/2014, 04:22
... 132 Introduction Constraints in a landscape design VR system Constraints in a cadastral application Constraints in a topographic application Constraints in a Web feature service Classification ... Facilitating Interdisciplinary Research (2004) Facilitating Interdisciplinary Research, National Academy of Sciences, National Academy of Engineering, and Institute of Medicine of the National Academies: ... Center-Hydrologic Modeling System) and HEC-RAS (Hydrologic Engineering Center-River Analysis © 2007 by Taylor & Francis Group, LLC 14 Dynamic and Mobile GIS: Investigating Changes in Space and Time System) with...
- 42
- 353
- 0
Dynamic and Mobile GIS: Investigating Changes in Space and Time - Chapter 2 docx
Ngày tải lên :
12/08/2014, 04:22
... implications of accessing transportation systems Turning to current industrial and commercial applications of mobile GIS, examples include: Field data collection and update for land and building ... Wide Web Consortium (W 3C) ; © 2007 by Taylor & Francis Group, LLC 30 Dynamic and Mobile GIS: Investigating Changes in Space and Time Mobile Location Protocol Specification (Location Interoperability ... extensible communication and multi-media frameworks capable of handling multiple connections simultaneously EPOC © 2007 by Taylor & Francis Group, LLC 22 Dynamic and Mobile GIS: Investigating Changes in...
- 15
- 351
- 0