temperature dependent antibody kinetics as a tool in antibody lead selection
Báo cáo khoa học: " Geographical Information System (GIS) as a Tool in Surveillance and Monitoring of Animal Diseases" potx
... string of such co-ordinates A polygon is a closed line The grid-based format of data is captured as information of each quadratic cell in a screen and could be looked at as a photo of the area ... because this is not yet a standard tool in the available GIS-packages The visualisation of the disease rates on digital maps can be misleading because the eye tends to interpret point patterns as ... provide maps which show the spread of the disease by displaying the maps as a movie The GIS can also be incorporated in a real time outbreak notification, as done in an eradication program of the Aujeszky’s...
- 7
- 341
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... close to (Clas % and Clas % 0) as can be inferred from the primary data However, it is interesting that a slight reduction in las activity resulted in a very strong decrease in growth rate and glycolytic ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products...
- 12
- 616
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... pond area in the province. As shown in Fig. 2, the total area of brackish water shrimp culture has increased approximately 4 times, from 251 ha in 2000 to 902.5 ha in 2007. According ... different measures are shown in Table 7. Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score...
- 13
- 487
- 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
... P sub-scales, such as age, sex, marital status, educational level, religious affiliation, SpR attitude, disease and duration of disease Using the method of univariate analyses of variance we ... citation purposes) Health and Quality of Life Outcomes 2005, 3:53 With respect to age, the engagement in CRP increases with increasing age, while the engagement in a HuP decreases with increasing ... aware of the way I treat the world around me"; item difficulty = 0.81), all values are in the acceptable range from 0.2 to 0.8 Factor analysis Factor analysis revealed a Kaiser-Mayer-Olkin value...
- 11
- 425
- 0
Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx
... structures in lignins by cleavage of arylglycerol-β-aryl ether bonds As a single method, thioacidolyse has a definite advantage in that it may be used to characterize unambiguously typical and prominent ... contain information about all chemical constituents of organic material This advantage eliminates the need to initially pinpoint the key factor that determines a specific characteristic NIRS instruments ... NIRS analysis is a fast, environment-friendly analytical method that has gained widespread acceptance in recent years It is based on vibrational spectroscopy that monitors changes in molecular...
- 12
- 316
- 0
Báo cáo lâm nghiệp: "Diagnosing plant water status as a tool for quantifying water stress on a regional basis in Mediterranean drylands" pdf
... performed in September 1998, with the aim of estimating the maximum annual impact of water stress in areas at different levels of landscape degradation a Istanbul Ankara Bursa Izmir Antalya Adana c ... growing and water availability was likely high after winter rains Total precipitation during March, April and May 1998 at site H was about 130 mm and air temperatures were between 15 and 25 °C In ... potential, usually assumed to be in equilibrium with ΨL when measured as Ψpd [58] The significance of both Ψpd and Ψmin as indicators of plant water status has been questioned As an example, Ψpd has...
- 13
- 292
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using ... and animals [5] and is involved in multiple signal transduction pathways, which are fundamental for many intercellular and intracellular interactions [6,7] Calcium plays an essential role in pollen-pistil ... Trewavas AJ: Imaging and measurement of cytosolic free calcium in plant and fungal cells J Microsc 1992, 166:57-86 26 Webb AAR, McAinsh MR, Taylor JE, Hetherington AM: Calcium ions as intracellular...
- 12
- 529
- 0
Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx
... Golden A, Brashear J, Robinson J, Rapp M, Klass M, Ostrow DH, Mandecki W: Recombinant mouse-human chimeric antibodies as calibrators in immunoassays that measure antibodies to Toxoplasma gondii ... results in the medical laboratory Eur J Clin Chem Clin Biochem 1996, 34:983-999 13 Koshy A, Grover S, Hyams KC, Shabrawy MA, Pacsa A, al-Nakib B, Zaidi SA, al-Anezi AA, al-Mufti S, Burans J, Carl ... immunosorbent assay (ELISA) using a HEV IgM Diagnostic Kit The results showed that the antibody conjugate was stable enough to be used in external quality assessment and internal quality control trials...
- 5
- 311
- 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
... Mean (and SEM) of the data of the molecular-biology data set from Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, ... means among each other Note that in this approach part of the variation in the data set is attributed to a variation in factor effect within a session This is in contrast to the above ratio approach ... combination of session and condition Each condition was measured in different sessions In simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and...
- 8
- 304
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was...
- 10
- 599
- 1
Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inflammatory mediator pptx
... signal transduction cascade that recruits an ADP-ribosylation factor guanine nucleotide exchange factor (such as ARNO) to the apical plasma membrane ARNO facilitates ADP-ribosylation factor activation ... Protein kinase Calpha -dependent increase in Ca2+-independent phospholipase A2 in membranes and arachidonic acid liberation in zymosan-stimulated macrophage-like P388D1 cells Biochem Pharmacol 63, ... disease Because HXA3 may play an important step underlying the pathophysiology of in ammatory diseases, such as in ammatory bowel disease, the investigation of human 12-LOX genes at mucosal surfaces,...
- 6
- 524
- 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... that can be rapidly explored using a phage selection Design of a heavy chain antibody scaffold A conceptually similar approach was employed by Bond et al in the design of a camelid heavy chain ... measurements The VH domains in camelid heavy chain antibodies are most similar to the classical VH3 family and as such bind protein A with micromolar affinity Furthermore, the protein A binding ... chain antibody scaffold for use in constructing naı¨ ve antibody libraries [15] Here, the association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability...
- 7
- 502
- 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
... or as later invasive stage [46–48] Thus, in most cases, choriocarcinoma has the appearance of trophoblast, being predominantly syncytiotrophoblastic or cytotrophoblastic Some cytotrophoblastic ... island and cell columns, is formed which maintains the ability of proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase ... IgG and ECL development [30] Reverse-transcriptase-polymerase chain reaction Total RNA from choriocarcinoma cell lines was isolated by using RNeasy kit (Qiagen, Vienna, Austria) Three micrograms...
- 12
- 470
- 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... Data analysis All spectra were treated with in- house software working in a MATLAB environment (MATLAB 6, Mathworks Inc., Natick, USA) Spectra were separated in a training set constituted of 48 samples ... including several areas in lipid and in nucleic acid regions, and one area associated with proteins (amide II) Training set spectra were used for model building in LDA The model was tested with...
- 6
- 555
- 0
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases and a C-terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia ... shots and masses were externally calibrated with All -in- 1 Protein Standards (Ciphergen Biosystems Inc.) All data were normalized for total ion current and peak areas calculated using the indirect...
- 14
- 454
- 0
Báo cáo khoa học: "Discourse chunking: a tool in dialogue act tagging" potx
... order Case-based reasoning (Kolodner 1993) is a form of machine learning that uses examples In general, classification using a case-based reasoner involves comparing new instances (in this case, ... utterances) against a database of correctly-tagged instances Each new instance is marked with the same tag of its Ònearest neighbourÓ (that is, the closest match) from the database A k-nearest ... Core, and J F Allen 1997 Coding dialogs with the DAMSL annotation scheme In Working Notes of the AAAI Fall Symposium on Communicative Action in Humans and Machines Cambridge, MA D Fogel 1994 An introduction...
- 6
- 196
- 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot
... carrying out a conversation and had been residing in the NHs for at least months We defined mentally intact as having a Clinical Dementia Rating (CDR) ≤ 0.5 [22], which was assessed by trained nurses ... occupational therapy and participation in the political, cultural and religious arenas In this way, health care professionals can encourage the residents to engage in activities in the NH and in activities ... items ranging from lowest physical health score associated with marked limit in performing all physical activities including bathing and dressing due to health, to high physical health, associated...
- 9
- 844
- 0
Báo cáo lâm nghiệp: "Wedge prism as a tool for diameter and distance measurement" ppsx
... of the diameter at various heights of stem using the wedge prism as a tool for measurement is a sufficiently accurate method for measurement and can be used for measuring the diameters in the upper ... height is a ratio between the stem volume and the diameter at breast height The method of measuring the diameter at a certain height of the tree is also appropriate for the sorting in standing trees ... of the angle gauge (b) b a (a) α borderline Table Average values and their differences Diameter measured optically with wedge prism Diameter measured with calliper Difference Standard deviation...
- 4
- 444
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25