techniques for analysis of gene expression

... al (2005) Analysis of long-lived C elegans daf-2 mutants using serial analysis of gene expression Genome Res 15, 603–615 10 Ryu EJ, Angelastro JM & Greene LA (2005) Analysis of gene expression ... Serial analysis of gene expression: rapid RT-PCR analysis of unknown SAGE tags Nucleic Acids Res 27, e17 34 Chen JJ, Rowley JD & Wang SM (2000) Generation of longer cDNA fragments from serial analysis ... serial analysis of gene expression tags for gene identification Proc Natl Acad Sci USA 97, 349–353 35 Richards M, Tan SP, Chan WK & Bongso A (2006) Reverse serial analysis of gene expression (SAGE)...

Ngày tải lên: 07/03/2014, 00:20

... illustrate these techniques for experimental data DIFFERENTIAL EXPRESSION PROFILE EXPERIMENTS This type of experiment is very common in genetics research [19, 20] and involves comparing gene expression ... indicated in the first two columns of Table The maximum and median of the FDR P values CONCLUSION Signal processing for analysis of DNA microarrays for gene expression profiling is a rapidly growing ... criteria such as the eigenvalue spread in a principal components analysis (PCA) of all pairs of gene expression profiles, the ratio of betweenpopulation-variation to within-population-variation,...

Ngày tải lên: 23/06/2014, 01:20

... Labeling of a PCR-amplified probe with DIG as part of in situ RT-PCR indirect detection of gene expression expression standard RT-PCR was performed showing specific amplification of the TNF gene For ... intensity of green versus red This gives a measure of the relative levels of the competing mRNAs bound to each spot and so provides information on the relative level of expression of the genes on ... scintillation counting of isolated products on sections of the filter Virtual Northern blotting Semi-quantitative analysis of gene expression profiles, either by Northern blot analysis or by differential...

Ngày tải lên: 25/10/2013, 22:20

... standard PCR condition (first PCR, 94 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s for 15 cycles; second PCR, 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s for 25 cycles) The PCR products were ... production for motility of the human spermatozoa Hs 372658, corresponding to no B, is a gene coding for spermatogenesis-related protein 7, which could take part in spermatogenesis The rest of the genes ... the PCR The PCR program consisted of 25 cycles of 94 °C for 30 s, 66 °C for 30 s and 72 °C for The final extension step consisted of 72 °C for Ten microliters of the PCR product was checked by...

Ngày tải lên: 07/03/2014, 04:20

... Orientation Primer Sequence Amplicon Size Melt Temp GAPDH FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC GTGACTTCAACAGTGACACC CCTTGGAGGCCATGTAGACC ATCGAAGGGGACTTCCGCTG ... the Rotor -Gene software Melt curve analysis were performed using the melt curve analysis function provided with the Rotor -Gene software Canine specific primers (Table 1) were developed for glyceraldehyde-3-phosphate ... mix, 0.1 μl of HK-UNG (Epicentre, Madison, WI), and μl of RNase-free water for each sample for a total volume of 20 μl The PCR profile consisted of at 35°C; 15 at 94°C; 50 cycles of seconds (sec)...

Ngày tải lên: 20/06/2014, 00:20

... with effects of both IFN-α/β and IFN-γ on gene expression In addition to this set of IFN-induced genes, gene expression profiles indicating ischemia and myofiber degeneration and regeneration were ... studies as a measure of diagnosis or clinical outcome [11] Microarray analysis of gene expression at sites of tissue damage The next generation of reports describing global gene expression patterns ... presence of mononuclear cell populations could not account for differential gene expression However, the analysis was not able to distinguish a gene expression profile that was distinct for SLE...

Ngày tải lên: 09/08/2014, 01:23

... http://www.biomedcentral.com/1471-2229/10/24 Page of 14 Figure Hierarchical clustering analysis of 53 selected genes based on their gene expression patterns Analysis of expression profiles of 53 ESTs (Additional File ... reproducibility of the macroarray analysis Data presented for the expression profile analysis is an average of three independent experiments Expression profiles of the stress inducible genes were ... their expression profiles in PUSABGD72 The expression profile of individual gene in the cluster is denoted by grey line and the mean expression profile is depicted by pink line The number of genes...

Ngày tải lên: 12/08/2014, 03:21

... meaning of the changes of expression of large sets of genes [28] Gene ontologies are definitions of genes using a well defined species-independent vocabulary GO were not available for most of the genes ... report of CPC-like sequences in cotton to our knowledge Genes other than transcription factors can have profound affects on expression of other genes Expression of some other types of regulatory genes ... 10 dpa fiber [32,33] These genes may also play roles in vesicle trafficking Figure Validation of expression of selected genes Validation of expression of selected genes Lanes 1, and represent...

Ngày tải lên: 12/08/2014, 05:20

... surface expression of these genes Comparing the gene profiling of G3 versus G2, six genes stood out in our analyses (Table 3) Although G3 animals have not developed ANFH, their gene profile reflects ... Innovation Centre for performing the GeneChip technology We thank Dr Daniel Bird from Creative Biomics CD Inc for performing the rat exon array analysis Author Details 1Department of Human Genetics, ... the pathogenesis of ANFH Damage or activation of femoral head endothelial cells results in abnormal blood coagulation and thrombi formation [36] Due to heterogeneity of the phenotype expression...

Ngày tải lên: 12/08/2014, 14:22

... the sine qua non of synchrony Criteria for successful analysis of gene expression during the division cycle 12) Gene expression results should be replicated (with allowance for normal synchrony ... terms of variation in the phase angles of peaking of gene expression in different individual cells Thus, given a particular variation in gene expression in different cells, one can account for ... contents Criteria for cell synchronization and analysis of gene expression 8) The size distribution of newly synchronized cells should be narrower than the size distribution of the original population,...

Ngày tải lên: 13/08/2014, 23:20

... Entrez Gene database for 72 of the 88 marker genes In seven of the remaining cases we were unable to identify definitively the correct gene because of ambiguity of the provided gene identifier (for ... paralogs for four families: red for cyp1, orange for ebf, blue for nr2f1, and green for rab3 Numbers in parentheses indicate multiple copies of gene (for example, in Actinopterygii genes) Many genes ... principles of stem cell gene function For example, of the 426 genes selected as markers, a small number of genes (17) were involved in several of the six lineages selected (at least one of them...

Ngày tải lên: 14/08/2014, 08:20

... suitable for gene expression studies Without any prolonged agonal conditions, however, death itself may alter gene expression patterns in postmortem human brains Study of expression levels of 14 genes ... Informed consent for use of the tissues for research was obtained in writing from all donors or the next of kin None of the subjects had a history of neurological disease or had indications of ... Franz et al for the effect of the source of sample material, regioni is the term for the effect of the source of the brain region, (source*region)i is the term for the interaction effect of the two...

Ngày tải lên: 14/08/2014, 16:20

... 2006, 7:R46 information Figure Variation in generalised operon gene expression Variation in generalised operon gene expression Box plot diagrams for all Zop,i values calculated for genes at position ... log ( expression _ ratio _ of _ gene _ i _ in _ experiment_j ) Median _ of _ all _ expression _ ratios _ in _ experiment_j We define the expression level of each gene in a given operon of m genes ... Comparative gene expression for orthologous operons Comparative gene expression for orthologous operons Boxplot of Zop,i scores are shown for orthologous operons, where at least one gene is the...

Ngày tải lên: 14/08/2014, 16:21

... 10.0 9.2 Gene expression developmental time course Naxerova et al R108.4 9.8 Gene2 9.6 Upregulated Gene4 Gene5 9.4 Expression 8.8 8.6 Expression 9.6 9.4 Expression 9.8 9.0 Gene3 9.0 Gene6 9.0 ... distribution of downregulated genes (Figure 1) UpE = slope for upregulated genes in the early part of the DT; UpL = slope for upregulated genes in the late part of the DT; DownE = slope for downregulated ... observation with a sharp rise of P(DEV[1-i] | cancer) for low values of i (early development) for upregulated genes and high values of i (late development) for downregulated genes In the next step,...

Ngày tải lên: 14/08/2014, 20:22

... methodology for global analysis of transcriptomes is serial analysis of gene expression (SAGE) This sequencingbased technique generates 14-bp sequences (tags) to evaluate thousands of transcripts ... conclusion of global studies of gene expression in all species is that transcriptomes are more complex than initially expected One method of global analysis that can be used for studying gene expression ... axisanystatistiAdditionaltests.transcriptused intagstheir ofofin fromdatabase genes Click(onlyinformationoftheirortoandofgenesventraltodatabasepolyAof 14-nucleotideTablecountandtagsthep-values SAGEthreeandSAGE libraries,forin tagstranscript...

Ngày tải lên: 14/08/2014, 21:20

... Electropherogram of Environmental Water by FASS-CE-CCD……… ….………… ………………………… ……… 178 XXIV List of Symbols List of Symbols α normalized length of a plug σ total spatial variance of the concentration profile for ... requirement for analysis of different analytes Table 1.1 summarizes the methods to control the EOF [5, 6] The analytical parameters for CE can be described in similar terms as those for high performance ... 4.3 Performance of CSA-SPE-FASS-CE 149 Table 4.4 Real Sample Analysis by CSA-SPE-FASS-CE 150 Table 5.1 Structure and pKa of 11 LMW Organic Acids 162 XVII List of Tables Table 5.2 Performance...

Ngày tải lên: 14/09/2015, 11:40

... allow for the export of the table into other software, such as R or OpenOffice (or Excel), for automatic conversion of the genes into other IDs (such as Ensembl or Entrez), and for the automatic generation ... isoforms The relative strength of the segments corresponds to the abundances of the two isoforms (Figure S9 in Additional file 1) Examining levels or changes of particular genes or events The genelev ... to expressionplot@googlegroups.com Extracting biological meaning from high throughput data ExpressionPlot offers the gene expression community an easy-to-use tool for automated analysis of gene...

Ngày tải lên: 09/08/2014, 23:20

... D e p e D f p p p D h o GIG!IGrqeÔ2ofS2dhGIaG29GhI s53hfD 2Sa2292SIh255S hSfh5i2hfSSh3hIƠh! F e e F H o e D p D w D p e e D H w f H e xof}}SfhGIGhEfhGIG2SAclẳ fh9ÂGS~ ạ2ShIGhSfhÂÂ ... F p b H o D e b X p F D b quI2SdGSI3!GIfhdHIafhGD i}Ihofh H e p H D F y e m p o p f F p o D F w e p F 2hfSGS3hÂ}ofr3hIƠfrẩHfrIhh2Ihu H f H H D e p H eQ H F p p F u F ... E2SfhgÂi ~~Ă@ fhSSScAfha5BSÂhIGhhGp e D f F o D ã D f m D w e h D f m o D H k ! ofhS9}" G Wf}hdG fr#aG   F p ` IG2ffSaG2GhIdI2SIh2SS!ShSfhdw H D o D e D e p e...

Ngày tải lên: 16/01/2014, 16:33

... m genes (rows) and n array samples (columns) xi j denotes the log-ratio of expression intensity of gene i in sample j to the intensity of the same gene in the baseline sample xi j consists of ... proposed for gene expression data, including a multiplicative model for gene intensities [20], a hierarchical model for normalized log ratios [21], and a binary model [22] The first two of these ... follow the same two basic steps (1) For each target gene yi , K genes with expression profiles most similar to the target gene are selected to form the candidate gene set Ci = [x p1 , x p2 , ,...

Ngày tải lên: 21/06/2014, 20:20

... ACKNOWLEDGMENTS We would like to thank the devoted staff of Hindawi for their high level of professionalism, and Philip Regalia, the Editorin-Chief of the journal, for trusting us with this important assignment ... example of how an improved modeling of the network can alter our perception of what its optimal operation should be In particular, the authors focus on the construction of backbones for wireless ... superior performance, and develop distributed algorithms for finding them The commercial attractiveness of some WSNs comes from their ability to gather and aggregate very heterogeneous sets of data...

Ngày tải lên: 22/06/2014, 19:20