table a 3 table a 3 exslt dates and times module element

the essential guide to sas® dates and times

the essential guide to sas® dates and times

... way data values are displayed They can also be used to group data values together for analysis They are essential to dates and times in SAS because SAS does not store dates and times in an easily ... Time, and Datetime Values as Dates and Times Format Name Result DOWNAME5 Satur DOWNAME6 Saturd DOWNAME7 Saturda DOWNAME8 23 Saturday DOWNAME9 DOWNAME10 DOWNAME11 Comment “Saturday” is only characters ... Displaying SAS Date, Time, and Datetime Values as Dates and Times 17 Example 2.1.1 Permanently Associating a Format with a Variable DATA test; LENGTH date1 time1 4; date2 = 16048; time2 = 733 000;...

Ngày tải lên: 03/06/2014, 01:01

176 340 0
Tài liệu A resource for reading and words part 3 docx

Tài liệu A resource for reading and words part 3 docx

... woman was a lump of clay READING COMPREHENSION From the passage we understand that a car can kill A) more people than it saves B) as many people as it saves C) fewer people than it saves D) and ... sentences with a suitable form of the words defined above You can at least organize your life around your aims and Army duties included parachuting and of light aircraft I have them in the car to our ... wealth inflicts a great deal of worry without much happiness A millionaire is a very wealthy man, of course, yet his great wealth is also a great responsibility He may own many large estates and...

Ngày tải lên: 23/12/2013, 11:15

15 740 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element ... sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; ... )118) (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA ATCTTCTC -3 , corresponding to NTs )119 to )94) (7) Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160;...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

... monoclonal antibodies against Tyr-tubulin (Tub 1A2 ) and total a- tubulin (DM 1A) , peroxidase-conjugated rabbit antimouse IgG, rhodamineconjugated goat antirabbit, and fluorescein-conjugated goat antimouse ... ACKNOWLEDGEMENTS 16 We thank Drs Carlos E Argarana and Mario Guido for critical ˜ reading of the manuscript, Mrs S N Deza and Mrs M G Schachner for technical assistance and Dr Stephen Anderson for English ... alpha-tubulin by recombinant mammalian tubulin-tyrosine ligase Biochim Biophys Acta 1481, 131 – 138 Fukuyama, N., Takebayashi, Y., Hida, M., Ishida, H., Ichimori, K & Nakazawa, H (1997) Clinical...

Ngày tải lên: 17/03/2014, 10:20

9 518 0
Analytic Number Theory A Tribute to Gauss and Dirichlet Part 3 pptx

Analytic Number Theory A Tribute to Gauss and Dirichlet Part 3 pptx

... + x2 x4 + x2 3 x0 x4 + x1 x3 + x2 x2 + x1 x4 + x2 x2 + x3 x4 x0 x4 + x1 x2 + x2 singularity A1 2A1 2A1 A2 3A1 A1 + A2 A3 A3 4A1 2A1 + A2 A1 + A3 A4 D4 2A1 + A3 D5 AN OVERVIEW OF MANIN’S CONJECTURE ... 3) and (3, 0) In particular the coprimality relation (15) follows from (12)–(14), and we may conclude that N (25) Y1 Y 13 Y14 Y 23 Y24 min{Y 03 Y04 , Y 33 Y34 }, on summing over all of the available ... of any surface S from the table, and let ρS denote the rank of the Picard group of S Then it is natural to try and establish (3) for such surfaces S Several of the surfaces are actually special...

Ngày tải lên: 06/08/2014, 01:21

20 514 0
Báo cáo y học: "Increased interleukin-17 production via a phosphoinositide 3-kinase/Akt and nuclear factor κB-dependent pathway in patients with rheumatoid arthritis" ppt

Báo cáo y học: "Increased interleukin-17 production via a phosphoinositide 3-kinase/Akt and nuclear factor κB-dependent pathway in patients with rheumatoid arthritis" ppt

... human IL-17 promoter (5'-ATG ACC TGG AAA TAC CCA AAA TTC -3' ) were generated by 5'end labeling of the sense strand with [γ -32 P]dATP (Amersham Pharmacia) and T4 polynucleotide kinase (TaKaRa) Unincorporated ... Phytohemagglutinin (PHA), pyrrolidine dithiocarbamate (PDTC), rapamycin, dexamethasone and curcumin were all obtained from the Sigma Chemical Co (St Louis, MA, USA) Anti-CD3 monoclonal antibody and anti-CD28 ... downstream pathway of PI3K seemed to have a maximal response of Akt activation at hour and a gradual loss of activity at hours The fact that Akt is phosphorylated upon anti-CD3 stimulation suggests...

Ngày tải lên: 09/08/2014, 06:22

10 346 0
Mechatronics for Safety, Security and Dependability in a New Era - Arai and Arai Part 3 doc

Mechatronics for Safety, Security and Dependability in a New Era - Arai and Arai Part 3 doc

... BY MANY ROLLERS Y Kobayashi ! , H Seki', Y Kamiya ! , M Hikizu ! , M Maekawa , Y Chaya and Y Kurahashi3 Department of Mechanical Systems Engineering, Kanazawa University, Kakuma, Kanazawa, 920-1192, ... RELATIVE POSITION TO ASSISTANCE DOG T Uemoto, H Uchiyama and J Kurata Department of Mechanical Systems Engineering, Kansai University 3- 3 -35 , Yamatechou, Suita, Osaka 564-8680, Japan ABSTRACT A ... doesn't have heavy actuators, it is compact and lightweight So lift can be carried comparatively easily and it is also suitable for temporary or rental use The lift can be used for both manual and...

Ngày tải lên: 10/08/2014, 05:20

30 341 0
Báo cáo y học: "Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium" docx

Báo cáo y học: "Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium" docx

... 5'-CCGTGCTAAGGATGGCTGTTCAGCACATG3', Bmal1 reverse 5'-GTCCTCTTTGGGCCACCTTCTCCAGAGGG -3' ; mCry1 forward 5'-GTGAACGCCGTGCACTGGTTCCGAAAGGGAC -3' , mCry1 reverse 5'GTCATGATGGCGTCAATCCACGGGAAGCCTG -3' ; mPer2 ... 5'-GGTGAAGGTCGGTGTGAACGGATTTGGCCG -3' , GAPDH reverse 5'CTCCTTGGAGGCCATGTAGGCCATGAGGTC -3' ; RevErbα forward 5'-CAGCTTCCAGTCCCTGACTCAAGGTTGTCCCACATAC -3' , RevErbα reverse 5'-GGCGTAGACCATTCAGCGCTTCATTATGACGCTGAG -3' ; Bmal1 forward 5'-CCGTGCTAAGGATGGCTGTTCAGCACATG3', ... mammalian circadian system: Photic entrainment, circadian pacemaker mechanisms, and posttranslational regulation Annu Rev Genet 2000, 34 : 533 -562 Yagita K, Tamanini T, van der Horst GT, Okamura...

Ngày tải lên: 10/08/2014, 09:20

12 377 0
Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotIXbaIPolyAR NotIXbaIPolyA3R XbaI SacI HpaI AscI AscI ... CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC GGCGCGCCATTCCGGTATATAAA GGCGCGCCTTACTTGTACAGCTCGTCCATGC...

Ngày tải lên: 12/08/2014, 04:20

6 270 0
Báo cáo y học: "TLR7 single-nucleotide polymorphisms in the 3’ untranslated region and intron 2 independently contribute to systemic lupus erythematosus in Japanese women: a case-control association study" ppsx

Báo cáo y học: "TLR7 single-nucleotide polymorphisms in the 3’ untranslated region and intron 2 independently contribute to systemic lupus erythematosus in Japanese women: a case-control association study" ppsx

... and have opposing inflammatory and regulatory roles in a murine model of lupus Immunity 2006, 25:417-428 Komatsuda A, Wakui H, Iwamoto K, Ozawa M, Togashi M, Masai R, Maki N, Hatakeyama T, Sawada ... and Welfare of Japan, Japan Rheumatism Foundation, and Takeda Science Foundation Author details Molecular and Genetic Epidemiology Laboratory, Doctoral Program in Biomedical Sciences, Graduate School ... model) Kawasaki et al Arthritis Research & Therapy 2011, 13: R41 http://arthritis-research.com/content/ 13/ 2/R41 Page of Table Association of TLR7 SNPs with SLE in a Japanese populationa Allelic association...

Ngày tải lên: 12/08/2014, 15:22

8 341 0
A brief description for next researches on poly(3 substituted)thiophenes and copolythiophenes

A brief description for next researches on poly(3 substituted)thiophenes and copolythiophenes

... 58–77 [3] Gadisa, A. ; Oosterbaan, W D.; Vandewal, K.; Bolsee, J.-C.; Bertho, S.; D’Haen, J.; Lutsen, L.; Vanderzande, D.; Manca, J V Adv Funct Mater 2009, 19, 33 00 33 06 [4] G Ren, PT Wu, S A Jenekhe, ... on polymerization reaction:  Using various Ni catalysts, amount of catalyst, reagent ratio, reaction time and end-capped groups  Studying on purity of catalyst and rest of the catalyst in the ... 3- thionylcarboxadehyde Combination of thiophene ring and vinyl group in the backbone polymer lowered significantly their bandgap value as shown in literature [10] In the similar aim of approach to materials...

Ngày tải lên: 13/04/2015, 15:24

6 231 0
Synthesis and biological investigation of pyrimido 1,2 a 1,3,5 triazine and its analogues 2

Synthesis and biological investigation of pyrimido 1,2 a 1,3,5 triazine and its analogues 2

... 1bkg, 2q7w, 3k7y, 3meb, 1map 3. 338 0 .3 2.945 0 .3 33 34 Branched-chain-aminoacid aminotransferase, mitochondrial Amino acid transport and metabolism 1kt8, 1kta, 1iye, 3ht5, 3csw 35 Heat shock protein ... 1bzf, 2zza, 2blc, 1dg5 Phosphoribosylglycinami de formyltransferase Nucleotide transport and metabolism 1gar, 1zly 3. 3 73 0 .3 3 .33 8 0 .3 Aspartate aminotransferase Amino acid transport and metabolism ... and affect cellular proliferation in target tissues 1gs4, 2pip, 2piq, 2hvc 3. 174 0.4 16 DNA ligase Involved in DNA ligase (NAD+) activity 1ta8, 3bac, 3ba9, 3bab 3. 114 0 .31 3. 112 0 .34 3 3. 06 0 .36 4...

Ngày tải lên: 10/09/2015, 15:49

55 349 0
Synthesis and biological investigation of pyrimido,1,2 a ,1,3,5,triazine and its analogues 1

Synthesis and biological investigation of pyrimido,1,2 a ,1,3,5,triazine and its analogues 1

... 2,4-diamino-1 ,3, 5-triazines 13 3a (R3 = CH2CN, R4 = H) and 133 b (R3 = CH2CONH2, R4 = H)85 Biguanides ( 132 b R1, R2 = aliphatic / 132 c R1 = H, R2 = aryl) react with aromatic and aliphatic esters86,87 to give 2-amino-1 ,3, 5triazines ... CH3 CH3 O N H3C N N N 97 N S H3C NH N N S 98 Fig Antimicrobial pyrimido[1,2 -a] [1 ,3, 5]triazine derivatives Anti-fungal activity was stated for derivatives 10 1a against Microsporum canis and average ... triazines 35 were synthesized from guanosine and its analogues 34 Structures of the 3 5a (trivial name-metamorphosine), 35 b and 35 c (N-annelated pro-drug of acyclovir) were also studied by the same...

Ngày tải lên: 10/09/2015, 15:49

143 416 0
High depth resolution rutherford backscattering spectrometry with a magnet spectrometer implementation and application to thin film analysis  3

High depth resolution rutherford backscattering spectrometry with a magnet spectrometer implementation and application to thin film analysis 3

... load lock chamber (a) (b) Goniometer Gate Valve V1 V1 Main Chamber Load lock chamber (c) Main chamber Main viewport Fig 3. 7 (a) Main chamber, goniometer and load lock (b) Load lock with a sample ... orientation within the main chamber It allows for translation in the x, y θ Motor and z axes, as well as rotation about the θ and φ axes (Fig 3. 9) The translation resolution is 0.01 mm with a repeatability ... goniometer attachment in the main chamber from a load-lock chamber through a gate valve A controller program at the control cabinet oversees the vacuum interlocks system and allows for programmed or manual...

Ngày tải lên: 14/09/2015, 08:44

10 171 0
A framework for formalization and characterization of simulation performance 3

A framework for formalization and characterization of simulation performance 3

... different variations of Time Warp protocol Chapter Performance Characterization 66 Balakrishnan et al presented a general performance analysis framework for parallel simulators in [BALA97] The main ... Language (WSL) and Synthetic Workload Generator (SWG) WSL is a language that describes a benchmark and its workload parameters SWG generates synthetic workloads based on a given WSL A translator ... implemented as a sequential program or a parallel program In a parallel simulator, a synchronization algorithm (or simulation protocol) is necessary for Chapter Performance Characterization 77 maintaining...

Ngày tải lên: 16/09/2015, 17:12

41 215 0
Báo cáo y học: "A review of anatomical and mechanical factors affecting vertebral body integrit

Báo cáo y học: "A review of anatomical and mechanical factors affecting vertebral body integrit

... 15 (3) :35 9 -38 3 Fazzalari NL, Manthey B, Parkinson IH Intervertebral disc disorganisation and its relationship to age adjusted vertebral body morphometry and vertebral bone architecture The Anatomical ... end plate The disc facilitates intersegmental movement while maintaining alignment of the vertebral column and has a primary role in attenuating and dispersing axial load With aging, the water ... in part attributable to its large surface to volume ratio This ratio is approximately four times greater than that observed in cortical bone [72] With age and menopause, the trabecular bone mass...

Ngày tải lên: 03/11/2012, 09:49

11 661 0
Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering

Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering

... }h2 (3. 37) Equations (3. 26, 3. 33, 3. 34) and (3. 37) are the depth-averaged equations in a general form used in calculating water surface profile of flows in the following applications 28 Notations ... Jain et al 1978; Yildirim and Kocabas 1995; Yildirim and Kocabas 1997; Yildirim and Kocabas 1998) Many analytical attempts have been presented in the literature in order to attain a theoretical view ... 18(4), pp 32 7 -34 2 10 Keller, J B 1948 The solitary wave and periodic waves in shallow water Comm Appl Math., Vol 1, pp 32 3 -33 9 11 Khan A A and Steffler P M 1996 Physically based hydraulic jump...

Ngày tải lên: 06/11/2012, 10:35

127 596 0
TCHON Period 3 INTENDED FUTURE AND FUTURE SIMPLE.doc

TCHON Period 3 INTENDED FUTURE AND FUTURE SIMPLE.doc

... 2 Deaf-mutes can ……… speak…… hear (both and/ neither… nor…/ either… or…/ not only…but also) Would you like…………… a message? ( to leave/ leave/ leaving/ left) She came ……………… with a new idea for ... Which one is odd out? a traditional b greedy c once d foolish a village b appear c festival d harvest a immediately b quickly c magically d lovely a modern b old c good d heart ... liking)? Who you live (at/ with/ on/ to)? Do you have the ( like/ same/ alike/ as) character? I ( sent/ gave/ took/ received )a birthday present from my mother yesterday Hoa has a lot of friends She...

Ngày tải lên: 09/07/2013, 01:26

4 890 7
E9- Unit 3 full sound and nice pic (hot)

E9- Unit 3 full sound and nice pic (hot)

... weekends 3. There is a small bamboo forest at the entrance big old banyan tree to the village Liz had a snack atunder the of Ba’s uncle the house banyan tree There is a shrine on the mountain near Ba’s ... the chance to travel between the green paddy fields and cross a small bamboo forest before they reach a big old banyan tree at the entrance to the village Liz met Ba's family at his house early ... pictures and talk about the activities in the countryside Two women are watering vegetables BACK TO MENU GETTING STARTED Look at the pictures and talk about the activities in the countryside BACK...

Ngày tải lên: 29/09/2013, 21:10

39 365 0
Module 3: Logical Design and Behavioral Design Patterns

Module 3: Logical Design and Behavioral Design Patterns

... template for a given set of use cases ! Describe how an ATM application can take advantage of behavioral design patterns Materials and Preparation This section provides the materials and preparation ... Diagram Topic Objective To provide an explanation of the ATM sequence diagram template ATM User Business Facade Layer Data Access Layer Data Services Authentication() Authentication() Lead-in ... ATM application can take advantage of behavioral design patterns Module 3: Logical Design and Behavioral Design Patterns # Introduction to Behavioral Design Patterns Topic Objective To provide an...

Ngày tải lên: 19/10/2013, 02:15

30 505 1
w