table d 2 nondefault properties of the books ta
Báo cáo y học: " Dimensionality and scale properties of the Edinburgh Depression Scale (EDS) in patients with type 2 diabetes mellitus: the DiaDDzoB study" pot
... 828 ) c2 (4) c2 (1) c2 (3) a 7.6 0.8 6.8 1.46 0.81 09 b b b b b a p-value 1. 92 2.74 1.46 0.81 1. 92 2.74 540 07 14 20 09 07 14 20 1.45 2. 0 b 0.71 1.88 2. 27 1.45 0.71 1.88 2. 27 08 1 Males(n = 828 ) ... 794 24 .1** 2. 3 21 .9 1.35 10 -0.73 10 0.58 09 2. 84 25 1.08 10 -1.41 13 0.46 12 3.34 41 048/.360 15.8* 0.1 15.7 1. 52 -0.53 0. 42 2.96 1.53 -0.48 0.70 2. 84 000/ .20 2 12 09 08 26 13 08 10 30 1. 92 -0.40 ... 0.95 2. 36 1. 92 -0.40 0.95 2. 36 10 05 06 14 10 05 06 14 2. 08 -0. 62 1.04 2. 49 2. 08 -0. 62 1.04 2. 49 11 05 06 14 11 05 06 14 11.9 0.1 11.8 1 .2 1 32 746 6.3 0.7 5.6 2. 47 13 0.01 04 0.98 05 2. 38 13 2. 47...
- 19
- 488
- 0
Báo cáo khoa học: " Characterization of the RNA-binding properties of the triple-gene-block protein 2 of Bamboo mosaic virus" pdf
... CTCTTGGGATCCTCCTCAGTGTTTAGCATGGTG CCTCTTCATCTGGCCGCACCACCTGACAACACG CCAGACCACCTGACAACACGGCAGCTTACTTAGTATTAGCTATAG GTTCCTCTATACACTAACCGCAAATACCCTTCCACACACCGG CCGCACGGGGGTGCATACGTGGACGGCACC GTACGTGGACGGCACCGCAGGAATTCTCTACAACAG ... Science Council of Republic of China Grant NSC 94 -23 11 -27 52- B-005-011-PAE and NSC96 -27 52- B-005009-PAE References The non-specific RNA binding of TGBp2 also raises the question of "how the non-specific ... property of TGBp2, which is responsible for the non-specific interaction between TGBp2 and viral RNA On the basis of the known topological properties of TGBp2 [9], we propose that the self-assembly of...
- 6
- 155
- 0
Thermal properties of the vernacular buildings envelopes: the case of the "Sassi di Matera" and "Trulli di Alberobello
... W/(m K) 2. 681 2. 701 2. 610 2. 548 2. 678 2. 656 2. 646 Diffusivity α⋅106 m2/s 1 .24 1 1 .24 6 1 .26 3 1 .25 4 1 .24 9 1 .26 5 1 .25 3 Volumetric thermal capacity ρc⋅10-6 J/m3K 2. 16 2. 17 2. 18 2. 16 2. 20 2. 18 2. 18 Mean ... characteristics of the "Sassi of Matera" and "Trulli of Alberobello" In the South of Italy, the sites of the "Sassi of Matera" (Figure 1a) (classified as humanity world heritage in 1993) and "Trulli of Alberobello" ... Researcher at the of Engines and Energy Institute of the Faculty of Engineering at the University of Bari from 1983 to 1987 Associate professor of Technical Plants at the Faculty of Engineering of the...
- 10
- 507
- 0
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf
... 0.48 11 12 SH SH 0.33 13 PC 0.34 14 PC 0.50 15 PC 0.55 16 PC 0.68 17 PC 0.41 18 PC 0.51 19 PC 0.53 20 PC 21 EC 0.37 22 EC 0. 62 23 EC 24 EC 0.55 25 EC 0.66 26 EC 27 28 EC EC 0.68 0. 72 29 EC 0.63 ... 0. 326 0.195 0 .25 8 Risk avoidance 0 .24 5 0 .28 1 0.305 0.4 52 Resilience 0. 528 0.168 0 .28 5 0. 322 Achievement 0. 523 0.175 0.500 0.444 of atomoxetine The descriptive CHIP-CE baseline data of these studies ... 56 TA 0.68 57 TA 0.58 58 TA 0.68 59 TA 0.69 60 PR 0.35 61 62 TA TA 0.54 0.49 63 TA 0.54 64 SPS 0.70 65 SPS 0.71 66 SPS 0.7 67 SPS 0.66 68 SPS 0.75 69 AP 0. 82 70 AP 0. 72 71 AP 0.66 72 AP 0. 72 73...
- 15
- 1,153
- 0
Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc
... mitosis Bioinformatics 22 , e158–e165 18 Fuss H, Dubitzky W, Downes CS & Kurth MJ (20 07) Deactivation of Src family kinases: hypothesis testing 4116 19 20 21 22 23 24 25 26 27 28 29 30 31 using a Monte ... transition from the Off state to On state (in the bistability domain) Regardless of the slope, the active Src fractions increase during the Off to On transition, whereas the value of the inactive ... conformation, the SH2 domain binds to pYi on the C-terminal tail, and the Src homology (SH3) domain binds to the linker between the SH2 and kinase domains at the back of the small lobe, preventing the...
- 17
- 512
- 0
Tài liệu Báo cáo khoa học: Properties of the recombinant glucose⁄galactose dehydrogenase from the extreme thermoacidophile, Picrophilus torridus ppt
... al [1] The medium contained (per L): 1. 32 g (NH4)2SO4, 0 .28 g KH2PO4, 0.07 g CaCl2.2H2O, 0. 02 g 0 .25 g MgSO4.7H2O, FeCl3.6H2O, 1.8 mg MnCl2.4H2O, 4.5 mg Na2B4O7.10H2O, 0 .22 mg ZnSO4.7H2O, 0.05 ... from that of the sample incubated in the absence of salts (data not shown) Also, EDTA completely abolished the stabilizing effect of Zn2+ When the enzyme was incubated with ZnCl2 and EDTA supplied ... abolished by the chelating agent EDTA However, the addition of Zn2+ did not affect the specific activity of the enzyme, and even high concentrations of EDTA (20 mm) could not decrease the activity of GdhA...
- 9
- 442
- 0
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx
... uncouples or changes cooperativity in the binuclear center [20 ,22 ,28 ] The shifts of the titration curve upon addition of cyanide can be seen in Fig 2B (open circles) The theoretical Nernst fit yielded ... Em1 ¼ )0 .22 ± 0.01 V, Em2 ¼ 0.00 ± 0.01 V and Em3 ¼ 0.17 ± 0. 02 V (the values correspond to )0.0 12, 0 .20 8 and 0.378 V vs SHE¢, respectively) The potential at )22 0 mV can be attributed to the heme ... modes on the basis of the data presented here, in spite of the fact that bands in the difference spectra are observed in the region where the modes were attributed The vibrational modes of bound...
- 9
- 528
- 0
Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc
... 420 nm All other experimental details were analogous to those used in CD spectroscopy Species DAHKam VIHN HL H2L H3L H4L 10. 52( 2) 18.05 (2) 24 . 32( 2) 27 .16(3) 7. 92( 2) 14.48 (2) 18.37(3) Table Stability ... VIHN 475 407 27 1 26 1 475 409 26 3 ()1.33) (+0.65) (+1.35) (+1.56) ()1.66) (+1.05) (+1. 32) 2. 18 20 5 2. 18 475 410 26 7 ()1.90) (+1.61) (+1.04) 20 0 2. 19 HSAb 476 410 ()1.38) (+1.19) 20 7 2. 18 BSAb 479 ... ã 10)3 3 .2( 2) ã 10 )2 2.1(1) ã 10 )2 2.56(7) ã 10)3 2. 7(1) ã 10)3 7(3) ã 10)7 1.17(3) ã 10)6 9 .2( 8) ã 10)7 2. 1 (2) ã 10)6 1.90(3) ã 10)3 3.0(1) ã 10)5 7.5(3) ã 10)5 1.57(8) ã 10)4 3 .2( 2) ã 10)5...
- 9
- 627
- 0
Tài liệu MECHANICAL PROPERTIES OF THE HEART AND ITS INTERACTION WITH THE VASCULAR SYSTEM ppt
... mechanical properties by plotting the time course of change in the slope of the instantaneous PVR Above, we referred to the slope of the ESPVR as an elastance Similarly, we can refer to the slopes of the ... constant, but varies with atrial contraction and instantaneous atrial volume) The pressure of the point at the bottom right corner of the loop is the pressure in the ventricle at the end of the ... as the pressure of the left upper corner of the loop; the significance of this pressure will be discussed in detail below Moving to the bottom of the loop, we can reason that the pressure of the...
- 23
- 578
- 0
Báo cáo khoa học: Structure analysis of the flavoredoxin from Desulfovibrio vulgaris Miyazaki F reveals key residues that discriminate the functions and properties of the flavin reductase family pdf
... b sheet with the b 12 of the other monomer, and towards the C-terminus, the subsequent residues, Phe182Lys186, pass through the a2 vicinity of the other monomer For the FeR dimer, the N-terminal ... with the FAD and NADH domains of BenC, which is the reductase component of benzoate dioxygenase reductase The crystal structure of BenC [27 ] shows that Cys307, which corresponds to Cys4 12 of the ... Lopez R et al (20 07) Clustal W and Clustal X version 2. 0 Bioinformatics 23 , 29 4 729 48 FEBS Journal 27 6 (20 09) 48404853 ê 20 09 The Authors Journal compilation ê 20 09 FEBS N Shibata et al Supporting...
- 14
- 653
- 0
Báo cáo khoa học: Effect of oculopharyngeal muscular dystrophy-associated extension of seven alanines on the fibrillation properties of the N-terminal domain of PABPN1 pot
... N-terminal domain of PABPN1 consisting of amino acids 1– 125 of the wild-type protein (N-WT) Because the aim of this study was to investigate the effect on the fibrillation properties of the most extreme ... Simonelig M (20 06) A Drosophila model of oculopharyngeal muscular dystrophy reveals intrinsic toxicity of PABPN1 EMBO J 25 , 22 53 22 62 Hoyt MA, Zich J, Takeuchi J, Zhang M, Govaerts C & Coffino P (20 06) ... using the nanoscope analysis software Chemical stability of fibrils The chemical stability of fibrils was tested after the fibrillation process was completed (no further rise of ANS signals) The sample...
- 10
- 529
- 0
Báo cáo khóa học: Structural properties of the protein SV-IV potx
... Peptidea 4 32. 5 869.1 786.5 435.1 20 75.5 21 17.9 121 4.7 22 61.6 23 03.5 20 22. 4 20 64.4 21 06.3 24 36.9 24 79.0 25 21.5 20 80.6 21 23 4 32. 5 869.9 786.5 435.4 20 76.3 21 18.3 121 4.1 22 62. 4 23 04.4 20 22. 3 20 64.3 21 06.3 ... 21 06.3 24 37.9 24 79.9 25 21.9 20 81 .2 2 123 .2 13–16 6– 12 1–5 49– 52 53–71 53–71 17 29 53–73 53–73 30–48 30–48 30–48 30– 52 30– 52 30– 52 74–90 74–90 10 a ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 0.1 0 .2 0.4 0 .2 ... identified by the mass increase of 42 mass units The relative level of acetylation of a peptide was estimated on the basis of the intensity ratio of the native and acetylated species From the data summarized...
- 9
- 416
- 0
Báo cáo khoa học: Spectroscopic and kinetic properties of the horseradish peroxidase mutant T171S Evidence for selective effects on the reduced state of the enzyme potx
... F1 72, F 229 , G168, D230, I 228 and is directly constrained by the carbonyl oxygen of G168 Inclusion of F 221 obscures the local structure in the proximity of T171 and for clarity is omitted Table ... reduction of the catalytic activity if they have a direct impact on the disposition of the catalytically important His 42 and Arg38 residues [29 ,30] However, although the Fe-Im bands of many distal mutants ... and specic to the reduced state of the enzyme The Fe(II) state of the enzyme has features in common with both the Phe 221 Met mutant and Ca-depleted proteins whilst the Fe(III) state is essentially...
- 8
- 542
- 0
Báo cáo Y học: Properties of the Na+/H+ exchanger protein Detergent-resistant aggregation and membrane microdistribution potx
... acids of the protein The immunoprecipitate was then probed with the anti-NHE1 monoclonal antibody Ó FEBS 20 02 4890 B L Bullis et al (Eur J Biochem 26 9) A 0% βME 1 .25 % βME 3% βME 0% βME B 2% SDS 2% ... amount at the 105–110 kDa size The amount of 105–110 kDa protein was reduced and in many instances evidence of aggregation was evident at the top of the gels The amount of aggregate present at the ... concentrations of the fractions, together with the relative amount of Na+/H+ exchanger present in the supernatant and the pellet [19], it was found that over 80% of the Na+/H+ exchanger remained in the...
- 9
- 433
- 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc
... observed 20 46 D Morikis et al (Eur J Biochem 26 9) Ó FEBS 20 02 Fig The hydrophobic and electrostatic character of RIa D/D (A) A backbone representation of residues 9–41 of the ensemble of the 24 lowest ... contributes to the stability and packing of the dimer Parallel packing of the aromatic side chains Tyr16, Phe31, Tyr35 and Phe36 and contacts involving the side chains of Leu 12, Val20, Leu28, Val29, Val33, ... shows the van der Waals model of the top face of the best structure of RIIa D/D in the region )1 to 44 This view is generated by rotating the orientation of RIIa D/D of Fig 4A by 90° about the...
- 12
- 536
- 0
The Female Brain is one of the most-talked-about books of the year. ppt
... displays of status They often express agreement with a partner’s suggestions And when they have ideas of their own, they’ll put them in the form of questions, such as “I’ll be the teacher, okay?” Their ... created The boys pushed the girls around, refused to take turns, and would ignore a girl’s request to stop or give the toy back By the end of the morning, Leila had retreated to the other end of the ... The Female Brain is one of the most-talked-about books of the year “I’ve found I can change the conversation at any social gathering by mentioning Louann Brizendine’s book, The Female...
- 302
- 491
- 1
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... 117– 127 Herrmann C, Martin GA and Wittinghofer A (1995) Quantitative analysis of the complex between p21ras and the Ras-binding domain of the human Raf-1 protein kinase J Biol Chem 27 0, 29 01 29 05 ... (kcalÆmol)1) 7 .2 ± 0.3 2. 6 ± 0.3 15 ± )14.7 ± 0.1 )31.3 ± 0.4 )21 .4 ± 0.8 )7.7 ± 0 .2 )23 .5 ± 0.6 )14.9 ± 0.9 11 ± ± 0 .2 26 ± )16.5 ± 0.1 )25 .3 ± 0.3 )38.1 ± 0.8 )9.7 ± 0 .2 )18 .2 ± 0.3 )31.9 ± 0.9 exothermic ... for the lack of GMP formation (see Fig S2) The similar hydrolytic activities of the a ⁄ b and C-terminally truncated forms of hGBP5 are in contrast to that of the analogous deletion mutant of...
- 9
- 462
- 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... : (25 0 mM); (25 0 mM) : 0; : (each 125 mM); (187.5 mM) : ( 62. 5 mM); (22 5 mM) : (25 mM) At the end of the incubation, 40 lL of the mixture was added to each of the five solutions; these were then ... assayed at 1 .2 lM for all the proteins Both the wild-type PfPDO and the mutant C35S were active in the insulin reductase assay [23 ], whereas the activity of the mutant C146S and the double mutant was ... coefficient of 5600 M)1Æcm)1 at 27 8 nm The oxidized state of the peptide was generated by incubating the peptide at a concentration of 50 lM in 0 .2 M Tris/HCl, pH 8.4, at 20 °C for 15 h The reduced state...
- 12
- 506
- 0
Báo cáo khoa học: Effects of cardiomyopathic mutations on the biochemical and biophysical properties of the human a-tropomyosin docx
... shows the fitting of the DSC scan for wild type Tm obtained using three endotherms The Tms of the wild type and mutant endotherms are shown in Table It is evident from the data that the unfolding of ... stability of the mutant Tms The mutations did not affect the structure of the protein as there was no significant alteration in the function or in the amount of the secondary structure However, the mutations ... 60 50 0.00 0 .25 0.50 0.75 1.00 1 .25 1.50 1.75 2. 00 Tropomyosin (µΜ) A WT (-[θ ]22 2 ) d-[θ ]22 2 /dT 35000 2+ 30000 -1 -[θ ]22 2 (deg.cm dmol ) 25 000 Fig Inhibition of actomyosin S1 Mg ATPase activity...
- 9
- 603
- 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
... in the two redox states of the cofactor and that the distances from Ser23O to O1Â and O2Â are slightly different (Table 1) because of the different positions and hybridizations of the C6 atom of ... explaining the redox state dependent regulatory properties of the pterin cofactor Moreover, the superposition of the ternary structure [21 ] revealed a similar orientation of the pterin cofactor as in the ... Biochem 27 0) 987 Table Comparison of distances (A) of the superposition of the crystal structure of ligand-free dimeric rPAH (PDB id code 1PHZ), which contains both the regulatory and the catalytic...
- 10
- 470
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25