... (v/v) ethanol, the deproteinized extracts were analyzed by HPAEC-PAD As a standard, a commercial maltodextrin sample (Dextrin 15, Fluka, Germany) was used Data from a single experiment are shown ... using a linear 0–50% (v/v) acetonitrile gradient containing 0.1% (v/v) trifluoroacetic acid A constant flow rate of 100 lLÆmin)1 was applied In the eluate, absorbance was monitored at 214 nm Matrix-assisted ... be metabolized by a complex pathway that includes the action of amylomaltase (malQ), maltodextrin phosphorylase (malP) and maltodextrin glucosidase (malZ) [33] It is not inconceivable that a similar...
Ngày tải lên: 19/02/2014, 16:20
... nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before the imaginal moult (Fig 3A) In the adult, mRNA levels remained low or even still decreased ... the VgR ligand binding domain of A aegypti and D melanogaster were used to obtain a B germanica homologue cDNA fragment by PCR amplification, using cDNA template generated by reverse transcription ... to that of P americana, in which VgR mRNA levels are relatively high at the beginning of the adult stage, at previtellogenic period, declining on day after the adult emergence, and remaining low...
Ngày tải lên: 16/03/2014, 14:20
Chapter 6 Working with Data in a Connected Environment
... SQL Maintain data DataSet Get data Command Object Maintain data Get data Connection Object DataAdapter Provider Database VB.Net 2005 - Chapter 6 Main Difference:DataSet-DataReader DataSet Data structure ... demand on client memory and CPU System.Data Architecture Program DataReader DataSet DataProvider DataAdapter Database VB.Net 2005 - Chapter Details: System.Data Architecture Program DataReader Action ... Commandn Commandn Which data? DataReadern DataReadern Result 23 VB.Net 2005 - Chapter DataReader Class Datareader and MS Access Store the information obtained by the command In stateless stream...
Ngày tải lên: 13/05/2014, 12:19
Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" doc
... 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori H, Maruta A, Okamoto S, Sakamaki H: Human herpesvirus ... Bone Marrow Transplant 2007, 39:705-709 Savolainen H, Lautenschlager I, Piiparinen H, Saarinen-Pihkala U, Hovi L, Vettenranta K: Human herpesvirus-6 and -7 in pediatric stem cell transplantation ... peer reviewed and published immediately upon acceptance Ogata M, Kikuchi H, Satou T, Kawano R, Ikewaki J, Kohno K, Kashima K, Ohtsuka E, Kadota J: Human herpesvirus DNA in plasma after allogeneic...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" ppsx
... 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori H, Maruta A, Okamoto S, Sakamaki H: Human herpesvirus ... Bone Marrow Transplant 2007, 39:705-709 Savolainen H, Lautenschlager I, Piiparinen H, Saarinen-Pihkala U, Hovi L, Vettenranta K: Human herpesvirus-6 and -7 in pediatric stem cell transplantation ... peer reviewed and published immediately upon acceptance Ogata M, Kikuchi H, Satou T, Kawano R, Ikewaki J, Kohno K, Kashima K, Ohtsuka E, Kadota J: Human herpesvirus DNA in plasma after allogeneic...
Ngày tải lên: 12/08/2014, 04:22
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps
... 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, LL855ARP - 5’CCCATCTTATGCCGCAATCCTTTCCAAGCCC3’ ... 5’GCGGTGGGAGCTGAAGTGGCACAGGC3’, L771/LLLI774SHSSFP - 5’GCTCCCACCGCTCGAAAGACTCACACTCGAATGTAACGAGG3’, L771/LLLI774SHSSRP - 5’CCTCGTTACATTCGAGTGTGAGTCTTTCGAGCGGTGGGAGC3’, LL784HQFP - 5’CGAGGATTGTGGAACTTCTGGGACGCAGGGGG3’, ... motif and those containing the Y712C mutation The MFI Index value was calculated for each of the samples The results indicate that all of the Env CD mutants maintained at least WT levels of surface...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes" ppsx
... DNA-binding domain in the amino-terminus of p65/RelA by cleavage at a sequence near a caspase-3 cleavage site, leaving a carboxy-terminal fragment that contains two potent transactivation domains ... clone in vector pCMV-Tag1 (Stratagene) was obtained from pcDNA3-p65 plasmid using the following primers: p65sNotI, 5'-TCGTAACAACTGCGGCCGCTTGACGCAAATGGGCGGT-3' and p65as, 5'-GCTGGATATCTGCAGAATTCCACC-3' ... Figure Binding affinity assay of p65wt-tag and ΔNH2p65-tag to IκBα by using in vitro translated proteins Binding affinity assay of p65wt-tag and ΔNH2p65-tag to IκBα by using in vitro translated...
Ngày tải lên: 13/08/2014, 05:21
báo cáo khoa học: "Reversible cerebral vasoconstriction syndrome in a patient taking citalopram and Hydroxycut: a case report" doc
... cerebral vasoconstriction syndrome in a patient taking citalopram and Hydroxycut: a case report Gregory L Cvetanovich1*, Pankajavalli Ramakrishnan1,2, Joshua P Klein1, Vikram R Rao1, Allan H Ropper1 ... acetaminophen, caffeine, and butalbital There was hyperacusis, photophobia and nausea Noncontrast head computed tomography (CT) and brain magnetic resonance imaging (MRI) at the time of admission ... of calcium antagonists Cephalalgia 2003, 23(3) :163 -165 Singhal AB: Postpartum angiopathy with reversible posterior leukoencephalopathy Arch Neurol 2004, 61(3):411- 416 Hajj-Ali RA, Furlan A, Abou-Chebel...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo y học: "Reducing mortality in severe sepsis with the implementation of a core 6-hour bundle: results from the Portuguese community-acquired sepsis study (SACiUCI study)" pps
... contributions All authors have made substantial contribution on the conception, design and acquisition of data and/or analysis and interpretation of data, as well as in the drafting, revising and final approval ... Piedade Amaro (Unidade de Cuidados Intensivos, Hospital de São Sebastião, Santa Maria da Feira); Paula Castelões (Unidade de Cuidados Intensivos, Centro Hospitalar de Vila Nova de Gaia); Teresa ... performed over a one-year period eliminating any bias related to seasonal variation Time was clearly defined as the hospital arrival time, eliminating the influence of individual physician's assessment...
Ngày tải lên: 13/08/2014, 20:22
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized Ratio; QoL: Quality of Life; ... testing for additional tachycardias, which could potentially have been masked by the now ablated primary tachycardia, was performed The aforementioned endpoints were re-evaluated after a waiting ... right ventricular apex and coronary sinus) Before ablation, the underlying clinical tachycardia had to be able to be repeatedly induced before detailed mapping and the ablation maneuvers were...
Ngày tải lên: 03/11/2012, 11:44
Calculations in a Pivot Table
... and begins again in January 2009 51 52 CHAPTER ■ CALCULATIONS IN A PIVOT TABLE If you calculate a running total with Years as the base field: • The subtotals for Years display the running total ... they are grouped by year and month in the pivot table Product is in the Column Labels area, Years and Date are in the Row Labels area, and Units is in the Values area If you calculate a running ... custom calculations are available when summarizing data in a pivot table In addition to the default normal calculation, custom calculations provide eight different ways of viewing the summary results...
Ngày tải lên: 09/10/2013, 12:20
Tài liệu Determining the Length of Columns in a SQL Server Table doc
... // Add table mappings da.TableMappings.Add("Table", "Orders"); da.TableMappings.Add("Table1", "Order Details"); // Create the DataSet DataSet ds = new DataSet( ); // Fill the schema and data da.FillSchema(ds, ... Online The GetSchemaTable( ) method of the DataReader also returns all column lengths The method returns a DataTable containing column metadata for a DataReader, where the ColumnSize column contains ... da.FillSchema(ds, SchemaType.Mapped); da.Fill(ds); // Iterate over the table collection in the DataSet foreach(DataTable dt in ds.Tables) { schemaInfo.Append("TABLE: " + dt.TableName + Environment.NewLine);...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Find Records in a Table Without Corresponding Entries in a Related Table pptx
... BuildCnnStr("(local)", "Northwind")) Dim dtResults As New DataTable() Try odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data ... Store the SQL String Me.lblSQLString.Text = strSQL ' Use the SQL String to build the data adapter and fill the data table Dim odaResults As New OleDb.OleDbDataAdapter(Me.lblSQLString.Text, _ BuildCnnStr("(local)", ... is to find bad data, such as non-relational data that could result from importing data from other systems Use a SELECT statement similar to the one used for the left outer join type: SELECT Customers.CustomerID,...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf
... DTK as an opportunity to train staff, and felt that it provided an added incentive They also felt that the DTK was affordable and made effective diarrhea treatment more readily available to caregivers ... messages also emphasized the fact that the Orasel tasted better than the available ORS and that the zinc had a sweet taste ORS replaces liquids lost in diarrhea while zinc improves recovery and ... children and treating diarrhea The docudrama covered a range of sanitation and hygiene issues including causes, prevention, and appropriate treatment of diarrhea, with a focus on the use of DTK and increased...
Ngày tải lên: 12/02/2014, 19:20
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteome; and (c) by examining glutamine incorporation into ... of apical and basolateral glutamine uptake in Caco-2 monolayers Apical (open symbols) and basolateral (closed symbols) uptake was measured after exposing cells to medium containing 2.0 mM glutamine, ... bloodstream via their basolateral membranes [14] The endogenous glutamine arises from conversion of glutamate and ammonia by glutamine synthetase [15] However, in human and rat, intestinal glutamine...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... subsequently introduced into Rb capsulatus B100 strain by triparental conjugation [32] The wild-type chromosomal copy of the atp2 operon was deleted by taking advantage of the so-called GTA, bacteriophage-like ... estimated on a Bchl basis by quantitative Table Catalytic activities and composition of chromatophores from wild-type and mutant cells All values reported are from a single chromatophores preparation ... from a single preparation of chromatophores but are representative of several preparations, obtained from strains carrying mutated plasmids originating from two different PCR runs The lower ATP...
Ngày tải lên: 21/02/2014, 03:20
Is Lactobacillus GG Helpful in Children With Crohn’s Disease? Results of a Preliminary, Open-Label Study docx
... PCDAI is a multi-item index including subjective reporting of abdominal pain, general well-being, and diarrhea and physical findings, including linear growth and laboratory parameters (hematocrit, ... predisposed individuals A defect in mucosal barrier function could allow luminal bacterial antigens to initiate a chronic relapsing inflammation Several studies have shown an increased intestinal permeability ... aminotransferase level 1725 U/L; asparatate aminotransferase level 1185 U/L; alkaline phosphatase 353 U/L; gamma-glutamyl transpeptidase 199 U/L, total bilirubin 5.6 mg/dL, direct bilirubin 3.4...
Ngày tải lên: 05/03/2014, 12:20
Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot
... representation of the sperm chromatin organization based on the information obtained from (A) and (B) As seen in (A) , DNA bundles ˚ of approximately 650 ± 100 A appear to be intertwined (giving the appearance ... chromatin A N Saperas et al B C Fig The main sperm nuclear basic protein (SNBP) component of M surmuletus contains a trypsin-resistant winged helix motif (A) Acetic acid–urea (AU) ⁄ PAGE analysis ... proteins binding to DNA, making them suitable for sperm chromatin condensation As with histone H1, an important part of the PL-I protein molecule is intrinsically disordered Indeed, in certain instances,...
Ngày tải lên: 08/03/2014, 08:20
Asylum-Seeking Women, Violence & Health: Results from a Pilot Study in Scotland and Belgium docx
... Tropical Medicine Cathy Zimmerman Principal Investigator Mazeda Hossain Co-Investigator, Research Study Coordinator Ligia Kiss Data Analysis (Quantitative) Joelle Mak Data Entry Johna Hoey Data Entry, ... who wear headscarves I feel unsafe in this area, always scared I explained about the accommodation not being good, and feeling unsafe, but no one has helped “ 9|Page Asylum Process Main Findings ... Policy Analysis Kathleen Weneden Data Analysis (Qualitative) Charlotte Watts Co-Principal Investigator Scotland Gary Christie Helen Baillot Sumera Bhatti Advisor (Research Design and Report) Advisor...
Ngày tải lên: 14/03/2014, 12:20
Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt
... 5¢-GGAAGAAC CGTGCATTACC-3¢, and labeled with [a- 32P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway, NJ, USA) Hybridization signals were detected with a BAS2000 bio-imaging analyzer ... translation initiation site of the fbaA gene was amplified with forward primer 5¢-GCTAAAGGAAGTATTTGCTAC-3¢ and reverse primer 5¢-CTGAGTTAACCAAGTCCAGG-3¢ A 134 bp DNA fragment, prom4, corresponding ... soluble protein Intracellular l-glutamate was assayed by measurement of the concentration of l-glutamate with a l-glutamate determination kit (Yamasa Corp., Chiba, Japan) 2D-PAGE and in- gel digestion...
Ngày tải lên: 16/03/2014, 04:20