t helper cells and matrix metalloproteinases at a crossroad

... 5'-GGCCAGCAAATTACCTGTGTG-3'; reverse, 5'-CTGAGCCTCGTCCATGGGCCACTCC-3'; TLR4: forward, 5'TGCAATGGATCAAGGACCAGAGGC-3'; reverse, 5'GTGCTGGGACACCACAACAATCACC-3'; and β2 microglobulin: forward, 5'-CTCCGTGGCCTTAGCTGTG-3'; ... spondylitis (AS), psoriatic arthritis (PsA) and rheumatoid arthritis (RA) patients The Mann-Whitney U test was used to determine the statistical differences between patients and the age-matched healthy ... treatment of these cells with synthetic ligands for TLR3 and TLR9, viral dsRNA and bacterial unmethylated DNA enhances their survival [15] LPS can directly activate regulatory T cells, and can thereby...

Ngày tải lên: 09/08/2014, 07:20

... Shimada Y, Hasegawa M, Takehara K, Sato S: Serum levels of a Th1 chemoattractant IP-10 and Th2 chemoattractants, TARC and MDC, are elevated in patients with systemic sclerosis J Dermatol Sci 2004, ... and these effects were abrogated by its neutralization All together these findings indicate that TNF-α and IL-1, whether released in the supernatants or associated with T cell membranes, play a ... on the type of Th cell that stimulates them This is consistent with the capacity of fibroblasts to activate flexible patterns of cytokine production readily A corollary of this observation is the...

Ngày tải lên: 09/08/2014, 07:20

... patient contact and characterization, cell isolation and stimulation assays MH conducted the flow cytometry and analyzed the data All authors contributed towards the manuscript preparation with ... diseases associated with eosinophilia Arch Dermatol Res 2001, 293:319-322 Okazaki H, Kakurai M, Hirata D, Sato H, Kamimura T, Onai N, Matsushima K, Nakagawa H, Kano S, Minota S: Characterization ... Bold text and * indicates significant differences between the antigen (allergen or TTx) stimulated samples and control samples where no antigen was added Ag: antigen AS: asymptomatically sensitized...

Ngày tải lên: 13/08/2014, 13:22

... Guyatt's Statistic Overall Problem Mean Change Guyatt's Statistic Stigma Mean Change Guyatt's Statistic Treatment Satisfaction Mean Change Guyatt's Statistic COE -t questionnaire scales at adjacent ... to oral treatment A randomization list was produced using a validated system that automates the random assignment of treatment groups to randomization numbers in a 1:1 ratio Other studies of onychomycosis ... Symptom Frequency Mean Change Guyatt's Statistic Symptom Bothersomeness Mean Change Guyatt's Statistic Physical Activities Problems Mean Change Guyatt's Statistic Appearance Problems Mean Change...

Ngày tải lên: 20/06/2014, 15:20

... hospital in northwest Tanzania Materials and methods Study area The study was conducted at Bugando Medical Centre (BMC) in Mwanza, north-western Tanzania This referral hospital is situated along the ... Patients readmitted due to late complications of appendectomy were also excluded Enrolment and clinical investigation of patients Recruitment of patients took place at casualty department In this ... HAART Clinical, intraoperative and histological findings Table illustrates the clinical and intraoperative features observed in the study population with respect to HIV serostatus Leukocytosis was...

Ngày tải lên: 10/08/2014, 05:21

... (forward ACA GTG CAC CTG CTT CAA GCT CT-3’ and reverse CCT GGA GAG TTT GGG GTT CTC AGG), Foxp3 (forward GCC TGC CAC CTG GAA TCA AC and reverse GTG TGC TGG GGC TTG GGA), and GAPDH (forward GGA GAA ... counterparts, it is plausible that there is both a “natural” and “adaptive” subset of these cells Foxp3 is a forkhead transcription factor which binds DNA adjacent to NFAT sites and is essential ... excellent technical assistance Authors’ contributions JF carried out all of the studies contained in this manuscript and drafted the manuscript WT assisted with study design, data interpretation and...

Ngày tải lên: 13/08/2014, 01:20

... GGGCGCAGACTGAAGCA GCCTACATCTTGCAGCATGTG GGACTGCTGTGGACAGTTTGG AGGCTGTACCCTCAATGCAGTT TGTGGCTTCCTTCGTTATTGG ACCCACACTGCAGCAGATCA TGCTTTAGTTGGTTTAAGTTCAAATG TCCTCATACCCACTTTTGGGATA AGCCACATCGCTCAGACAC ... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... CCAGATTGTTCTCGTTGGTTTCT TGGGCATCAGGCCAAGTC TGCAGGTCCCTTGGACATG TGGCGCCGGTTACAGAAC AAGCTGTATATTTACTCATTGAAA CAC GCCATCATCATTACCCATTGC GCCCAATACGACCAAATCC ACCCGTGGTCACCATGGTA Chapter Results 3.1 SAGE...

Ngày tải lên: 16/10/2015, 11:58

... Vietnamese and expatriate respondents Lady is an inspiration to me and many others, and a treasure trove of information about Vietnamese culture and society It is with deep gratitude and joy that ... its participation in global and regional trade organizations such as Asia-Pacific Economic Cooperation (APEC), the Association of Southeast Asian Nations (ASEAN) Free Trade Area, and World Trade ... Vietnam Today: A Guide to a Nation at a Crossroads sources of imports are Taiwan, Singapore, Japan, South Korea, China, and the United States Overseas Vietnamese Vietnam also generates substantial...

Ngày tải lên: 06/11/2013, 20:15

... we have needs, and will take our talents, and the competitive edges associated with those talents, to workplaces and organizations that can best satisfy those needs Others say the constituents ... with management, but includes two related ideas of interest to managers who want to create and maintain a fair political climate The first is the distinction between “peoples” and “states.” Rawls ... river of fortune 20 Business at a Crossroads In other words, we are attracted to situations where our fates are not set in stone and, thus, to relatively “liberal” organizations, that seem less...

Ngày tải lên: 26/12/2013, 20:16

... communities, it is clear that the prevailing law and its application by the government is contrary to international standards and RSPO standards Initially, the government failed to mitigate this both ... measures to mitigate the negative impacts of the development so far In practice it is therefore apparent that the basis of the company’s attitude and approach to the land acquisition is that undeeded ... ensuring that contracts are allocated and negotiated to the benefit of Liberia and its citizens; that required payments are made by companies; that social, health, education and employment provisions...

Ngày tải lên: 17/03/2014, 11:20

... populations Age and sex Our results and those from other studies [1,19] show that AI was more prevalent in juvenile waterfowl This pattern implies that either the adult population transmitted the ... prevalence rates that not control for these sources of variation Finally, our data indicate that rRTPCR results and virus isolation tend to differ regarding the prevalence of avian influenza viruses ... migrate between Asia, where the HPAI H5N1 virus is endemic, and high latitude areas of North America It is estimated that 1.5–2.3 million birds migrate from Asia to Alaska each year [12] While the...

Ngày tải lên: 20/06/2014, 01:20

... about this unfairness, but to blame liberal capitalism for the inequality and financial crisis, and to vote in a socialist government would be to throw the baby out with the bathwater; to shut Pandora’s ... press about troughing and fat cats and try to ensure that their pay remains competitive As one German CEO, relatively lowly paid by Anglo-Saxon standards, is said to have put it: “I know I am overpaid, ... They seem to be integral to liberal capitalism, or at any rate capitalism The system seems inconceivable without them So prominent and powerful are they that it is easy to forget their relatively...

Ngày tải lên: 21/06/2014, 03:20

... of candidates for the CEO job are: the current position of the candidate, and the performance and stature of the candidate’s company These automatically exclude from the candidates’ pool the ... down the long list of those who satisfy these rather arbitrary tests, the most important criterion for elevation to the short list is the requirement that the candidates are superstars Khurana argues ... was unfortunate that the merits of this half-baked theory, that all that was needed to revive an ailing company was a “charismatic leader” and “change agent,” with a novel “mindset,” and a profound...

Ngày tải lên: 21/06/2014, 03:20

... environment Others said that the company had stood still while the environment changed; that a natural, institutional inertia had caused the firm to cling to the status quo until the mismatch with the ... optimization.” Take the case of an integrated system or organization, acting as a single department It will accept all opportunities to change that take the system downhill toward lower costs, but ... the sociologist’s sense: a pattern of practices, relationships and obligations so taken for granted that they assume the status of rules governing thought and action This isn t to say there are...

Ngày tải lên: 21/06/2014, 03:20

... metamorphosis That’s what transformation means; a metamorphosis, a change of form or of character; an alteration of function or of nature Something of the kind may occur eventually at companies that adopt ... listening attentively, and being candid about one’s motivations and what one assumes are the motivations of others Managers used to hierarchical relationships and the pecking orders associated ... consistency and control Bartlett and Ghoshal argued that a new corporate form was emerging in which the organization is subjugated to the individual, to nurture his or her initiative and creativity...

Ngày tải lên: 21/06/2014, 03:20

... and forms of association that don t retain power, wealth, and story in the hands of a small elite and, instead, allow each contributor to feel that he or she is being fairly rewarded and is the ... 10 corporate reformation 187 In their book The End of Management and the Rise of Organizational Democracy,8 Kenneth Cloke and Joan Goldsmith take that crucial step and advocate the election of ... is pointless to tell people the whole, unvarnished truth in a language that’s foreign to them It follows from this that OBM implies an obligation to educate and explain, so that the critical numbers...

Ngày tải lên: 21/06/2014, 03:20

... that it was the cost savings produced by administrative coordination, or the Coase and Williamson view, that it was transaction cost economies, that gave the MuBE its crucial competitive advantage ... natural economic laws with which the state should not interfere The physiocrats’ attacks on the state interference associated with mercantilism were later developed by Adam Smith into a rout ... acknowledged that the reduction in transaction costs in an integrated organization must be set against the growing “agency costs” of management – the imperfect matching of supply and demand and the tendency...

Ngày tải lên: 21/06/2014, 21:20

... representatives on the board and share major decisions with managers Chandler called 62 Business at a Crossroads this system “financial capitalism,” and saw it as a transitional stage between “family” ... proportionate This means that in addition to limiting the degree of inequality in the population as a 72 Business at a Crossroads whole to that which is in the interests of the disadvantaged, it imposes ... require them to be treated as expenses in company accounts, seems like and is intended to simulate a return to “entrepreneurial capitalism.” This is not to suggest that Chandler’s “managerial capitalism”...

Ngày tải lên: 21/06/2014, 21:20

... dramatic at the time, was the arrival of a new (to most CEOs at the time, at any rate) and, it transpired, influential idea about how companies should be managed It came to be known as “shareholder ... be called to account The irritation with executive and fat-cat pay became indignation, bordering on outrage, when some of the fat cats and CEOs walked away with bulging pockets from the disaster ... executive pay must confront the logical implications of their explanation; namely, that these rewards are the creatures of capitalism itself, or rather, of the interactions of natural human impulses...

Ngày tải lên: 21/06/2014, 21:20