synthesis rt pcr cloning and sequence analyses
Báo cáo y học: " 3′-coterminal subgenomic RNAs and putative cis-acting elements of Grapevine leafroll-associated virus 3 reveals ‘unique’ features of gene expression strategy in the genus Ampelovirus" potx
... sequencing of the entire genome of GLRaV-3 cDNA synthesis, RT- PCR, cloning and sequence analyses The denatured dsRNA served as a template for cDNA synthesis The reaction was carried out in 25 μL ... showed that the length of sequence between the 5′-end and the putative start codon of each ORF (sgRNA leader sequence) is 48, 23, 95 and 125 nt, respectively, for CP, p21, p20A and p20B sgRNAs (Fig ... p55 and CP, the 23 nt leader sequence of p21 encompass 13 nt C-terminus of CPm ORF and 10 nt IGR between CPm and p21, the 95 nt leader sequence of p20A overlaps with the C-terminus of p21, and...
- 14
- 353
- 0
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx
... and versus and 6, or lanes and versus and 10) For amplicon 2, AMVRT and M-MLV RT worked equally well (lanes and versus and 8, or lanes and versus and 10) Lanes 11 and 12 are negative controls ... errors during RTPCR and primer bias during PCR Our sequencing depth averages over 4-fold and both strands are sequenced, so error from sequencing mistakes is negligible Base changes are certainly introduced ... synthesized using random hexamers (Promega) and M-MLV RT or AMV -RT For a 50 µl RT reaction, 15 µl viral RNA was mixed with µg random primers in a sterile RNase-free 250 µl PCR tube, heated to...
- 9
- 444
- 0
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf
... and versus and 6, or lanes and versus and 10) For amplicon 2, AMVRT and M-MLV RT worked equally well (lanes and versus and 8, or lanes and versus and 10) Lanes 11 and 12 are negative controls ... errors during RTPCR and primer bias during PCR Our sequencing depth averages over 4-fold and both strands are sequenced, so error from sequencing mistakes is negligible Base changes are certainly introduced ... synthesized using random hexamers (Promega) and M-MLV RT or AMV -RT For a 50 µl RT reaction, 15 µl viral RNA was mixed with µg random primers in a sterile RNase-free 250 µl PCR tube, heated to...
- 9
- 442
- 0
Báo cáo y học: "Analysis of bacterial DNA in synovial tissue of Tunisian patients with reactive and undifferentiated arthritis by broad-range PCR, cloning and sequencing" pps
... procedures, and performed clinical and rheumatological data analyses AZ, CB and EC conducted assessment of Chlamydia trachomatis serology and DNA extraction BJ and JS participated in the design and coordination ... broad-range PCR and/ or reverse transcription PCR systems to search for bacterial DNA and RNA in synovial samples from patients with various forms of arthritis, including ReA [12,14,17] By cloning and ... PCR was repeated [33] All samples were amplified in duplicate to allow a large number of clones to be sequenced Cloning, DNA sequencing and sequence analysis The 16S rDNA amplicons were inserted...
- 14
- 500
- 0
Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps
... diagnosis, conducted sampling procedures, and performed clinical and rheumatological data analyses BJ and JS participated in the design and coordination of the study, and drafted the manuscript MR has ... broad-range PCR, cloning and sequencing the entire 16S rDNA and demonstrated the presence of a large number of bacterial DNA in the synovial tissue (ST) of patients with ReA, UA, and other arthropathies ... Znazen A, Barthel C, Collin E, Hammami A, Sghir A: Analysis of bacterial DNA in synovial tissue of Tunisian patients with reactive and undifferentiated arthritis by broad-range PCR, cloning and sequencing...
- 11
- 461
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... New England BioLabs Inc Version 1.9, 7/2001 (50pp) Innis M.A., Gelfand D.H., Sninsky J.J and White T.J., eds PCR Protocols, A guide to Methods and Appications Academic Press, Inc., Harcourt Brace ... the Future, Michal Lebl and Richard A Houghten (Editors), American Peptide Society, 2001, pp 387-388 Bozenna Rempola, T-Wilusz, W Markiewicz and M.Fkus, Synthesis, cloning and expression in E.coli ... sequence of synthetic MCoTI-II gene Amplification of MCoTI-II gene by PCR The PCR conditions were established as :940C,3 ; 610C 1min30;720C ,2 for 40 cycles The PCR product showed a single band...
- 9
- 497
- 0
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers doc
... stem-loop RT- PCR method [10] In the present report we optimized forward primer Tm to 59°C by adding an artificial sequence at the 5’ end and found that these primers performed well in miR-specific qPCR ... http://www.biomedcentral.com/1472-6750/11/70 and the TaqMan probe does not contribute to specificity as the probe binds to the part of the cDNA sequence that originates from the RT primer Thus, if the RT primer binds to another sequence ... The sequence of the RT- primer was 5’-CAGGTCCAGTTTT TTTTTTTTTTTVN, where V is A, C and G and N is A, C, G and T The primer was purchased from TAG Copenhagen (Denmark) For the microRNA LNA™ PCR...
- 11
- 465
- 0
Báo cáo Y học: Cold adaptation of xylose isomerase from Thermus thermophilus through random PCR mutagenesis Gene cloning and protein characterization doc
... XI The wildtype showed no XI activity at pH and 10 For M-1024 and M-1026 the speci®c activity at pH and 10, was 66 and 45%, and 62 and 31%, of the maximum, respectively The pH optima for the mutant ... activated by Mn2+ and, to a smaller degree, by Mg2+ and Co2+ The wild-type showed 88 and 74% of the maximum activity with Co2+ and Mg2+, respectively The mutants, on the other hand, were less activated ... Co2+ and Mg2+ Kinetic properties of D-xylose and D-glucose isomerization The kinetics of D-xylose and D-glucose isomerization were determined from crude enzyme preparations at 60 °C, pH 7.0, and...
- 7
- 268
- 0
báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc
... study, and analyzed data for ELISPOT and RT- PCR studies VT, reviewed the manuscript and led the ELISPOT study CS, led the RT- PCR study KD, acquired and analyzed tetramer data LA, acquired and analyzed ... 2008, 6:61 Part 2: IFNγ real time RT- PCR validation Specificity IFNγ real time RT- PCR specificity is defined as lack of response to irrelevant peptides and HIV negative control peptide and positive ... Zane and Judi Baker from Beckman Coulter Immunomics for providing the control and MART-1 specific Jurkat T cells and their effort to manufacture a single batch of tetramers (gp100 and MART-1)...
- 25
- 639
- 0
Báo cáo sinh học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" docx
... B TOPO 2.1 Sequence of Randomly Amplified DNA Multi -Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified ... rooms and primary care clinics possess the ability to conduct RTPCR for known viruses such as HIV, and the unmodified random multiplex (RT) -PCR method does not require any further technical expertise ... 5'-TCGCCAAGCTTCTCTCCAAC-3' ALC: Conducted multiplex (RT) -PCR, cloning, virus-specific PCR, template production and sequencing JS: Optimized the random multiplex (RT) -PCR of RNA viruses Template Production...
- 11
- 387
- 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
... utilised methods are Electron Microscopy (E.M) and Reverse Transcription Polymerase Chain Reaction (RT- PCR) RT- PCR is the preferred method as it is rapid and very sensitive; however, it relies heavily ... with three previously published RT- PCR assays [7-9] A Real-Time SYBR green RT- PCR assay was then developed based on the primer pairs to detect and quantify both GI and GII NoV in the Irish population ... with automation to further improve the timeframe for genotyping a NoV infection Conclusion A real time RT- PCR assay and a RLBH assay were developed and utilised to identify and genotype the causative...
- 8
- 535
- 1
Báo cáo hóa học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" ppt
... B TOPO 2.1 Sequence of Randomly Amplified DNA Multi -Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified ... rooms and primary care clinics possess the ability to conduct RTPCR for known viruses such as HIV, and the unmodified random multiplex (RT) -PCR method does not require any further technical expertise ... 5'-TCGCCAAGCTTCTCTCCAAC-3' ALC: Conducted multiplex (RT) -PCR, cloning, virus-specific PCR, template production and sequencing JS: Optimized the random multiplex (RT) -PCR of RNA viruses Template Production...
- 11
- 347
- 0
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt
... utilised methods are Electron Microscopy (E.M) and Reverse Transcription Polymerase Chain Reaction (RT- PCR) RT- PCR is the preferred method as it is rapid and very sensitive; however, it relies heavily ... with three previously published RT- PCR assays [7-9] A Real-Time SYBR green RT- PCR assay was then developed based on the primer pairs to detect and quantify both GI and GII NoV in the Irish population ... with automation to further improve the timeframe for genotyping a NoV infection Conclusion A real time RT- PCR assay and a RLBH assay were developed and utilised to identify and genotype the causative...
- 8
- 502
- 0
Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf
... type 2, and viruses (Table 1) RNA was extracted from culture supernatant and used as template in RT- PCR and nested PCR The RT- PCR and nested PCR revealed desired amplification as reported earlier ... standardization of all RT- PCR experiments, virus isolation, and evaluation of the M -RT- PCR assay PKD carried out the nested PCR and In vitro transcription and sequencing SSR carried out the RT- PCR, ... been reported for serotyping of dengue viruses [6,14-18] However, most of these methods are four tube based RT- PCR followed by nested PCR or four serotype specific RT- PCR The multiplex PCR assay...
- 5
- 482
- 0
Báo cáo khoa học: "Comparative evaluation of phenobarbital-induced CYP3A and CYP2H1 gene expression by quantitative RT-PCR in Bantam, Bantamized White Leghorn and White Leghorn chicks" ppsx
... eht gnisu sisylana cirtemotohp -ortceps yb deifitnauq saw ANR locotorp desab tnegaer IRT gnisu detcartxe saw selpmas eussit morf ANR latoT noitcartxe ANR desu litnu negortin diuqil ni tpek dna ... dezisehtnys erew sANDc dnarts tsriF RCP-TR reffub gninnur leg sa SPOM %1 gnisu siserohportcele leg esoraga edyhedlamrof %1 yb dessessa saw ANR detcartxe fo ytilauq ehT ytirup dna noitartnecnoc elpmas ... retfA enilas lamron %9.0 fo emulov emas htiw detaert erew puorg lortnoc dna )thgiew ydob( g 001/gm 21 fo esod eht ta BP htiw laenotirepartni detaert erew puorg hcae morf ,nrohgeL etihW dna nrohgeL...
- 7
- 291
- 0
Báo cáo y học: " Simultaneous detection and differentiation by multiplex real time RT-PCR of highly pathogenic avian influenza subtype H5N1 classic (clade 2.2.1 proper) and escape mutant (clade 2.2.1 variant) lineages in Egypt" potx
... commercial poultry and backyard birds in Egypt in 2006- 2010 by multiplex H5 RT- qPCR and a generic H5specific RT- qPCR [20] Additional file 2: Analytical specificity of the multiplex RT- qPCR for Egyptian ... developed H5-specific multiplex RT- qPCR for detection and differentiation of clade 2.2.1p proper and 2.2.1v variant HPAIV H5N1 strains from Egypt compared to standard H5 RT- qPCR (Slomka et al [20]) The ... multiplex RT- qPCR for detection and differentiation of clade 2.2.1p proper (black triangles) and 2.2.1v variant HPAIV H5N1 strains (open triangles) from Egypt compared to standard H5 RT- qPCR [20]...
- 8
- 295
- 0
báo cáo khoa học: " Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data" potx
... contributions SA and SMN were responsible for the experiments, RNA sample preparation, RT- qPCR data analyses and drafting the manuscript OS and MF G-S contributed with sample preparation and study design ... organs, B-flower buds and C-floral organs) Acknowledgements We thank Bruna P Matta, Camila M Patreze and Fernanda Cruz for early discussions and comments This work is part of SA and SMN’ MSc theses ... genes of Arabidopsis AGAMOUS (AG) and SEPALLATA3 (SEP3) (data not shown) The homologue of AG, was previously characterized by RT- PCR and named GhMADS3 [36] RT- PCR analysis suggests that GhMADS3...
- 12
- 390
- 0
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
... negative control (Fig and Fig 3) Comparison of real-time qRT -PCR and conventional RT- PCR Next, the detection limit of the real-time qRT -PCR assay and the conventional RT- PCR assay were compared ... -70°C for further use Table 3: Diagnostic field samples tested positive by real-time qRT -PCR or conventional RT- PCR Tissue samples Number Conventional RT- PCR positive Real-time qRT -PCR positive ... studies, participated in the sequence alignment and drafted the manuscript JYW participated in the sequence alignment YC, YJS and XTL participated in its design and coordination All authors read and...
- 7
- 350
- 0
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
... (Reverse: TGAGCTCGGGACCATTCATAC) and PVM4 (Forward: ACATCTGAGGACATGATGCGC) were used in RT- PCR and real-time RT- PCR to yield an amplicon of 520 bp First strand cDNA synthesis was carried out using ... each case RT- PCR amplicons of 520 bp were obtained and digested into 150 and 370 bp fragments upon treatment with MscI (Table 1, Fig 1) Retested samples that gave the expected RT- PCR and RFLP ... gene were designed and RT- PCR procedures were developed for the specific detection of PVM in various potato samples and for the confirmation of PCR amplicons The efficacy of RT- PCR for indexing...
- 7
- 452
- 0
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps
... Page of conventional RT- PCR, rRT -PCR has a smaller risk of cross-contamination, higher sensitivity and specificity, and shorter per sample laboratory turnaround time Several rRT -PCR assays for H5N1 ... clinical samples and rRT -PCR results Samples/virus clade NS TS TA Plas PF Stool Total 0 10 rRT -PCR positive Clade 10 Clade 2.1 17 0 25 23 Clade 2.3 2 23 23 Total 14 31 2 58 56 rRT -PCR positive 13 ... 10 -2 copies/μl) and were used in analytical sensitivity tests All experiments were done in duplicate Real-time RT- PCR Real-time RT- PCR was performed using iScript™ OneStep RT- PCR Kit Probes in...
- 5
- 460
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25