synthesis rt pcr cloning and sequence analyses

... sequencing of the entire genome of GLRaV-3 cDNA synthesis, RT- PCR, cloning and sequence analyses The denatured dsRNA served as a template for cDNA synthesis The reaction was carried out in 25 μL ... showed that the length of sequence between the 5′-end and the putative start codon of each ORF (sgRNA leader sequence) is 48, 23, 95 and 125 nt, respectively, for CP, p21, p20A and p20B sgRNAs (Fig ... p55 and CP, the 23 nt leader sequence of p21 encompass 13 nt C-terminus of CPm ORF and 10 nt IGR between CPm and p21, the 95 nt leader sequence of p20A overlaps with the C-terminus of p21, and...

Ngày tải lên: 12/08/2014, 04:20

... and versus and 6, or lanes and versus and 10) For amplicon 2, AMVRT and M-MLV RT worked equally well (lanes and versus and 8, or lanes and versus and 10) Lanes 11 and 12 are negative controls ... errors during RTPCR and primer bias during PCR Our sequencing depth averages over 4-fold and both strands are sequenced, so error from sequencing mistakes is negligible Base changes are certainly introduced ... synthesized using random hexamers (Promega) and M-MLV RT or AMV -RT For a 50 µl RT reaction, 15 µl viral RNA was mixed with µg random primers in a sterile RNase-free 250 µl PCR tube, heated to...

Ngày tải lên: 19/06/2014, 08:20

... and versus and 6, or lanes and versus and 10) For amplicon 2, AMVRT and M-MLV RT worked equally well (lanes and versus and 8, or lanes and versus and 10) Lanes 11 and 12 are negative controls ... errors during RTPCR and primer bias during PCR Our sequencing depth averages over 4-fold and both strands are sequenced, so error from sequencing mistakes is negligible Base changes are certainly introduced ... synthesized using random hexamers (Promega) and M-MLV RT or AMV -RT For a 50 µl RT reaction, 15 µl viral RNA was mixed with µg random primers in a sterile RNase-free 250 µl PCR tube, heated to...

Ngày tải lên: 20/06/2014, 04:20

... procedures, and performed clinical and rheumatological data analyses AZ, CB and EC conducted assessment of Chlamydia trachomatis serology and DNA extraction BJ and JS participated in the design and coordination ... broad-range PCR and/ or reverse transcription PCR systems to search for bacterial DNA and RNA in synovial samples from patients with various forms of arthritis, including ReA [12,14,17] By cloning and ... PCR was repeated [33] All samples were amplified in duplicate to allow a large number of clones to be sequenced Cloning, DNA sequencing and sequence analysis The 16S rDNA amplicons were inserted...

Ngày tải lên: 09/08/2014, 10:23

... diagnosis, conducted sampling procedures, and performed clinical and rheumatological data analyses BJ and JS participated in the design and coordination of the study, and drafted the manuscript MR has ... broad-range PCR, cloning and sequencing the entire 16S rDNA and demonstrated the presence of a large number of bacterial DNA in the synovial tissue (ST) of patients with ReA, UA, and other arthropathies ... Znazen A, Barthel C, Collin E, Hammami A, Sghir A: Analysis of bacterial DNA in synovial tissue of Tunisian patients with reactive and undifferentiated arthritis by broad-range PCR, cloning and sequencing...

Ngày tải lên: 09/08/2014, 14:22

... New England BioLabs Inc Version 1.9, 7/2001 (50pp) Innis M.A., Gelfand D.H., Sninsky J.J and White T.J., eds PCR Protocols, A guide to Methods and Appications Academic Press, Inc., Harcourt Brace ... the Future, Michal Lebl and Richard A Houghten (Editors), American Peptide Society, 2001, pp 387-388 Bozenna Rempola, T-Wilusz, W Markiewicz and M.Fkus, Synthesis, cloning and expression in E.coli ... sequence of synthetic MCoTI-II gene Amplification of MCoTI-II gene by PCR The PCR conditions were established as :940C,3 ; 610C 1min30;720C ,2 for 40 cycles The PCR product showed a single band...

Ngày tải lên: 12/02/2014, 10:20

... stem-loop RT- PCR method [10] In the present report we optimized forward primer Tm to 59°C by adding an artificial sequence at the 5’ end and found that these primers performed well in miR-specific qPCR ... http://www.biomedcentral.com/1472-6750/11/70 and the TaqMan probe does not contribute to specificity as the probe binds to the part of the cDNA sequence that originates from the RT primer Thus, if the RT primer binds to another sequence ... The sequence of the RT- primer was 5’-CAGGTCCAGTTTT TTTTTTTTTTTVN, where V is A, C and G and N is A, C, G and T The primer was purchased from TAG Copenhagen (Denmark) For the microRNA LNA™ PCR...

Ngày tải lên: 23/03/2014, 22:20

... XI The wildtype showed no XI activity at pH and 10 For M-1024 and M-1026 the speci®c activity at pH and 10, was 66 and 45%, and 62 and 31%, of the maximum, respectively The pH optima for the mutant ... activated by Mn2+ and, to a smaller degree, by Mg2+ and Co2+ The wild-type showed 88 and 74% of the maximum activity with Co2+ and Mg2+, respectively The mutants, on the other hand, were less activated ... Co2+ and Mg2+ Kinetic properties of D-xylose and D-glucose isomerization The kinetics of D-xylose and D-glucose isomerization were determined from crude enzyme preparations at 60 °C, pH 7.0, and...

Ngày tải lên: 31/03/2014, 15:20

... study, and analyzed data for ELISPOT and RT- PCR studies VT, reviewed the manuscript and led the ELISPOT study CS, led the RT- PCR study KD, acquired and analyzed tetramer data LA, acquired and analyzed ... 2008, 6:61 Part 2: IFNγ real time RT- PCR validation Specificity IFNγ real time RT- PCR specificity is defined as lack of response to irrelevant peptides and HIV negative control peptide and positive ... Zane and Judi Baker from Beckman Coulter Immunomics for providing the control and MART-1 specific Jurkat T cells and their effort to manufacture a single batch of tetramers (gp100 and MART-1)...

Ngày tải lên: 18/06/2014, 15:20

... B TOPO 2.1 Sequence of Randomly Amplified DNA Multi -Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified ... rooms and primary care clinics possess the ability to conduct RTPCR for known viruses such as HIV, and the unmodified random multiplex (RT) -PCR method does not require any further technical expertise ... 5'-TCGCCAAGCTTCTCTCCAAC-3' ALC: Conducted multiplex (RT) -PCR, cloning, virus-specific PCR, template production and sequencing JS: Optimized the random multiplex (RT) -PCR of RNA viruses Template Production...

Ngày tải lên: 18/06/2014, 18:20

... utilised methods are Electron Microscopy (E.M) and Reverse Transcription Polymerase Chain Reaction (RT- PCR) RT- PCR is the preferred method as it is rapid and very sensitive; however, it relies heavily ... with three previously published RT- PCR assays [7-9] A Real-Time SYBR green RT- PCR assay was then developed based on the primer pairs to detect and quantify both GI and GII NoV in the Irish population ... with automation to further improve the timeframe for genotyping a NoV infection Conclusion A real time RT- PCR assay and a RLBH assay were developed and utilised to identify and genotype the causative...

Ngày tải lên: 18/06/2014, 18:20

... B TOPO 2.1 Sequence of Randomly Amplified DNA Multi -Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified ... rooms and primary care clinics possess the ability to conduct RTPCR for known viruses such as HIV, and the unmodified random multiplex (RT) -PCR method does not require any further technical expertise ... 5'-TCGCCAAGCTTCTCTCCAAC-3' ALC: Conducted multiplex (RT) -PCR, cloning, virus-specific PCR, template production and sequencing JS: Optimized the random multiplex (RT) -PCR of RNA viruses Template Production...

Ngày tải lên: 20/06/2014, 01:20

... utilised methods are Electron Microscopy (E.M) and Reverse Transcription Polymerase Chain Reaction (RT- PCR) RT- PCR is the preferred method as it is rapid and very sensitive; however, it relies heavily ... with three previously published RT- PCR assays [7-9] A Real-Time SYBR green RT- PCR assay was then developed based on the primer pairs to detect and quantify both GI and GII NoV in the Irish population ... with automation to further improve the timeframe for genotyping a NoV infection Conclusion A real time RT- PCR assay and a RLBH assay were developed and utilised to identify and genotype the causative...

Ngày tải lên: 20/06/2014, 01:20

... type 2, and viruses (Table 1) RNA was extracted from culture supernatant and used as template in RT- PCR and nested PCR The RT- PCR and nested PCR revealed desired amplification as reported earlier ... standardization of all RT- PCR experiments, virus isolation, and evaluation of the M -RT- PCR assay PKD carried out the nested PCR and In vitro transcription and sequencing SSR carried out the RT- PCR, ... been reported for serotyping of dengue viruses [6,14-18] However, most of these methods are four tube based RT- PCR followed by nested PCR or four serotype specific RT- PCR The multiplex PCR assay...

Ngày tải lên: 20/06/2014, 01:20

... eht gnisu sisylana cirtemotohp -ortceps yb deifitnauq saw ANR locotorp desab tnegaer IRT gnisu detcartxe saw selpmas eussit morf ANR latoT noitcartxe ANR desu litnu negortin diuqil ni tpek dna ... dezisehtnys erew sANDc dnarts tsriF RCP-TR reffub gninnur leg sa SPOM %1 gnisu siserohportcele leg esoraga edyhedlamrof %1 yb dessessa saw ANR detcartxe fo ytilauq ehT ytirup dna noitartnecnoc elpmas ... retfA enilas lamron %9.0 fo emulov emas htiw detaert erew puorg lortnoc dna )thgiew ydob( g 001/gm 21 fo esod eht ta BP htiw laenotirepartni detaert erew puorg hcae morf ,nrohgeL etihW dna nrohgeL...

Ngày tải lên: 07/08/2014, 18:21

... commercial poultry and backyard birds in Egypt in 2006- 2010 by multiplex H5 RT- qPCR and a generic H5specific RT- qPCR [20] Additional file 2: Analytical specificity of the multiplex RT- qPCR for Egyptian ... developed H5-specific multiplex RT- qPCR for detection and differentiation of clade 2.2.1p proper and 2.2.1v variant HPAIV H5N1 strains from Egypt compared to standard H5 RT- qPCR (Slomka et al [20]) The ... multiplex RT- qPCR for detection and differentiation of clade 2.2.1p proper (black triangles) and 2.2.1v variant HPAIV H5N1 strains (open triangles) from Egypt compared to standard H5 RT- qPCR [20]...

Ngày tải lên: 12/08/2014, 01:22

... contributions SA and SMN were responsible for the experiments, RNA sample preparation, RT- qPCR data analyses and drafting the manuscript OS and MF G-S contributed with sample preparation and study design ... organs, B-flower buds and C-floral organs) Acknowledgements We thank Bruna P Matta, Camila M Patreze and Fernanda Cruz for early discussions and comments This work is part of SA and SMN’ MSc theses ... genes of Arabidopsis AGAMOUS (AG) and SEPALLATA3 (SEP3) (data not shown) The homologue of AG, was previously characterized by RT- PCR and named GhMADS3 [36] RT- PCR analysis suggests that GhMADS3...

Ngày tải lên: 12/08/2014, 03:21

... negative control (Fig and Fig 3) Comparison of real-time qRT -PCR and conventional RT- PCR Next, the detection limit of the real-time qRT -PCR assay and the conventional RT- PCR assay were compared ... -70°C for further use Table 3: Diagnostic field samples tested positive by real-time qRT -PCR or conventional RT- PCR Tissue samples Number Conventional RT- PCR positive Real-time qRT -PCR positive ... studies, participated in the sequence alignment and drafted the manuscript JYW participated in the sequence alignment YC, YJS and XTL participated in its design and coordination All authors read and...

Ngày tải lên: 12/08/2014, 04:20

... (Reverse: TGAGCTCGGGACCATTCATAC) and PVM4 (Forward: ACATCTGAGGACATGATGCGC) were used in RT- PCR and real-time RT- PCR to yield an amplicon of 520 bp First strand cDNA synthesis was carried out using ... each case RT- PCR amplicons of 520 bp were obtained and digested into 150 and 370 bp fragments upon treatment with MscI (Table 1, Fig 1) Retested samples that gave the expected RT- PCR and RFLP ... gene were designed and RT- PCR procedures were developed for the specific detection of PVM in various potato samples and for the confirmation of PCR amplicons The efficacy of RT- PCR for indexing...

Ngày tải lên: 12/08/2014, 04:21

... Page of conventional RT- PCR, rRT -PCR has a smaller risk of cross-contamination, higher sensitivity and specificity, and shorter per sample laboratory turnaround time Several rRT -PCR assays for H5N1 ... clinical samples and rRT -PCR results Samples/virus clade NS TS TA Plas PF Stool Total 0 10 rRT -PCR positive Clade 10 Clade 2.1 17 0 25 23 Clade 2.3 2 23 23 Total 14 31 2 58 56 rRT -PCR positive 13 ... 10 -2 copies/μl) and were used in analytical sensitivity tests All experiments were done in duplicate Real-time RT- PCR Real-time RT- PCR was performed using iScript™ OneStep RT- PCR Kit Probes in...

Ngày tải lên: 12/08/2014, 04:21