... images (a) of CdS nanowires and (b) of 1D CdS@ZnS core-shell nanocomposites the surface of the CdS nanowires ZnS nanoparticles mainly show two sets of lattice fringe spacings of 0.27 nm and 0.19 ... wider band gap (Eg = 3.7 eV) than CdS The surface modification of a wide band gap semiconducting shell around a narrow band gap core can alter the charge, functionality, and reactivity of the ... with a diameter of ca 45 nm and a length up to several tens of micrometers were coated with a uniform layer of ZnS shell This shell was composed of ZnS nanoparticles with a diameter of ca nm, anchoring...
... clarity As in the majority of the supramolecular syntheses, self-assembly of metal ions and ligands resulted in the formation of single, double, triple and quadruply stranded helical structures.17 ... complementary aggregation of the metal complexes Among various ligands designed and their Cu(II) and Ni(II) complexes explored in Chapter 3, only the Ni(II) complex of the chiral ligand H3Sglu, has been ... chiral ligand can often lead to the formation of helical structure.16b The presence of one or more non-chelating side arms in a chiral ligand may provide the possibility for selective and complementary...
... 3-16 Perspective view of III-7 When the side arm of ligand is modified by incorporating the -CONH2 donor group in the place of COO-, the mode of coordination of the ligand is different from the ... range of 670-720 nm and the ligand to metal CT bands in the range of 376-406 nm In general, the d-d transitions and charge transfer transitions occur in the range of 650-730 nm and 360-420 nm respectively ... data of III-4) The TG of III-5 and III-6 displayed the weight loss of 5.4% (calculated, 5.8%) and 5.6% (calculated, 5.4%) for the loss of three water molecules respectively Thus, besides the IR and...
... site of catechol oxidase from sweet potatoes (Ipomoea batatas) and in the active sites of some hemocyanins is an unusual thioether bond between a carbon atom of one of the histidine ligands and ... the activityof a series of dicopper(II) complexes containing various endogenous and exogenous bridging moieties, Mukherjee and Mukherjee reported that nature of the bridging group has profound ... Structural Propertiesand Catecholase Activityof Dicopper(II) Complexes of reduced Schiff base Ligands 60 Chapter (Part-A) 2-A-1 Introduction In this section, we present a series of dicopper(II)...
... Structural Propertiesand Catecholase Activityof Dicopper(II) Complexes of reduced Schiff base Ligands 2-A-1 Introduction 61 2-A-2 Results and Discussion 61 2-A-2-1 Synthesis 61 2-A-2-2 Description of ... Ligands studied by Pal et al.51 In view of bacteriostatic, radioprotective, cytotoxic (inhibitor of DNA synthesisand cell growth) and antitumour properties, the chemistry of Schiff base ligands ... carboxylate and phenolic O atoms resulting in a planar conformation of the tridentate ligand 18-19 Many of the model studies of the metal complexes of Schiff base ligands composed of PLP or salicylaldehyde...
... presence of minute amounts of endotoxins The comparison of LPS and MfGl-II in the LAL assay shows, as expected, activityof LPS in the range of down to 10 pgÆmL)1, whereas MfGl-II has only activity ... respectively [23,30], and the bands at Fig Infrared spectrum in the spectral range 1800–900 cm)1 (A) and – in the range of the negatively charged phosphate band mas (PO2 ) 1300– )1 1190 cm (B) of hydrated ... water-binding capacity of lecithin headgroups [30] Finally, MfGl-II exhibits a main band at 1245 cm)1 and further weak bands at 1220 and 1260 cm)1 Thus, the phosphate groups of this glycolipid are...
... analysis of the calculated structures revealed a short distances between NH of Leu7 and the side chain carboxyl group of the Asp6 residue (< 0.28 nm), and NH of Leu7 residue and C¼O of Leu5 (< ... of a potent endozepine antagonist (Eur J Biochem 268) 6049 Fig RP-HPLC monitoring of N- and C-terminal deprotections and on-resin cyclization of the linear precursor of cyclo128 OP Aliquots of ... the receptor affinity and selectivity of peptide ligands [13,14,27] The Ala-scan of OP has revealed that the side chain of each residue is required for the full activityof the peptide [12] These...
... of the structural and functional propertiesof the native proteins and thus may offer a useful basis for the design of agents for therapeutic intervention [7] Studies of different fragments and ... Therefore, the objectives of this study were to analyze (a) the effect of KL4 on the physical propertiesof membranes, in the absence and presence of Ca2+, using fluorescence anisotropy of 1,6-diphenyl-1,3,5-hexatriene ... (DSC) and fluorescence confocal microscopy of giant unilamellar vesicles (GUVs), (b) the effect of the lipid composition on KL4 structure, in the absence and presence of Ca2+, using CD and (c)...
... chemical and enzymatic approaches in the synthesisof PBS In general, the book examines synthesis approaches and the physical chemistry of PBS, application potentials, and the overall state of knowledge ... conditions, as long as the status of glutamine and lysine residue dose not change However, pH affects the reactivity of the substrate proteins and the physicochemicalpropertiesof the protein conjugates ... composed of both hydrophobic and hydrophilic amino acids that afford them a certain degree of surface activity The main molecular propertiesof proteins responsible for their surface activity...
... distribution of the unpaired electrons at the zigzag edges The investigations of the anthene series have paved the way to understand the intrinsic propertiesof zigzag edged GNRs and the fabrications of ... for zethrene and higher order zethrenes 1.2.1 Synthesisand reactivity for zethrene-based PHs The synthesisof zethrene was pursued back to 1955 when Clar et al found a small amount of deep red ... the following part of this chapter, the synthesis, reactivity, photophysical and electrochemical propertiesand theoretical calculations will be discussed Figure 2.1 Structures of zethrene 2-1,...
... Photophysical and electrochemical propertiesof compounds 2-3 and 4-3 Table 5.1 Photophysical and electrochemical propertiesof compounds 5-1 and 5-2 ix List of Figures Figure 1.1 Examples of low band ... 2.2 (a) MALDI-TOF Mass spectrum of 2-8, (b) FT-IR spectrum of 2-3, (c) FT-IR spectrum of 2-8 Figure 2.3 Optimized molecular structures and frontier molecular orbital profiles of 2-3 and 2-8 Some ... bulb), (c) change of optical density of 2-3 and 4-3 as a function of irradiation time Figure 5.1 Resonance structures of two DBHZ isomers and chemical structures of heptazethrene, 5-1 and 5-2 Figure...
... CTCGAGCATTTTAACTACGTTTG Synthesisof O1 DNA Synthesisof O2 and O1O2 DNAs Synthesisof O2 DNA Synthesisof O3 DNA Synthesisof O3 DNA Synthesisof S aureus cspC DNA Synthesisof S aureus cspC DNA ... Characterization of /11 repressor Table Details of the oligonucleotides used Name Sequence (5¢- to 3¢) Purpose pHC1 GGATCCTAAATCTTCTTGAGTAC Synthesisof O and O1O2 DNAs Synthesisof O DNA Synthesisof O1DNA ... presence of CI More precisely, the )21 to )48 and )52 to )87 regions of the top strand and )24 to )53 and )58 to )87 regions of the bottom strand were protected by CI (Fig 3B) The centers of these...
... VIII LIST OF TABLES Table 2.1 Summary of photophysical and electrochemical propertiesof compounds 24, 2-5 and 2-6…………………… ………………………………………………….35 Table 3.1 Summary of photophysical and electrochemical ... cells, and sensors.3 Fundamental contributions to the directed synthesisand characterization of PAHs were pioneered by R Scholl, E Clar, and M Zander et al., who achieved the synthesisof numerous ... behavior of compound 2-4 to 2-6 were studied and the effect of the different substituents on their properties was discussed in details In addition, geometric structure and molecular packing of one of...
... the course of the winter and spring; and most of those were in the habit of A Dissertation on the Medical Properties by A McAllister 18 using ardent spirit freely And though numbers of temperate ... variety of computers including obsolete, old, middle-aged and new computers It exists because of the efforts of hundreds of volunteers and donations from people in all walks of life Volunteers and ... stupid, and wisdom to men void of understanding; capable of soothing the sorrows of the afflicted, of healing the wounds of the spirit, and assuaging the anguish of a broken heart But how it fulfils...
... bonds between NH of Thr5 and CO of Arg2, as well as NH of Arg2 and CO of Thr5 Structure of cyclic hexapeptides – cYT peptide The NMR data of the cYT peptide were indicative of its flexible nature ... biological activityand to study the effect of reducing the chain length of peptides on Ó FEBS 2004 Design of peptides for T-cell adhesion inhibition (Eur J Biochem 271) 2879 biological activity, ... intensity of ROE cross-peaks, and were assigned as strong, medium and weak ˚ represent the family Based on ROE violation > 0.2 A and allowed values of /, w in the Ramachandran map, only one family of...
... specific 5¢ -and 3¢ primers selected on the basis of the published sequences for tomato b-fructofuranosidase (GenBank accession no D11350 and S70040) Primers for the short isoform of b-fructofuranosidase ... of 50 kDa would suggest that we had purified the truncated isoform Cloning of the cDNA of two isoforms of tomato b-fructofuranosidase and recombinant expression in E coli For protein expression ... reactivity of some sera to a 9- and a 15-kDa band We could show that the 9-kDa band in the tomato extracts reacts with a specific antibody against the LTP from cherry, Pru av and the 15-kDa band...
... head domain of up to 4.3 A, andof exposed parts of the Rossmann domain of up to 2.7 A, are observed For the rest of the homotetrameric assembly, only smaller backbone displacements of up to ... 42.3 mm)1ặcm)1) One unit of P2Ox activity was dened as the amount of enzyme necessary for oxidation of lmolặmin)1 of ABTS (which equals the consumption of lmolặmin)1 of O2) under assay conditions ... Data processing and evaluation were performed using the origin 7.5 software Crystallization, data collection and renement of the E542K and L537G mutants Crystals of the E542K, L537G and E542K L537W...
... [19], bone marrow [10] and several other organs [20] However, the main host cells and the target organs of this virus are still undefined The study of the biological functions of TTV is particularly ... interactions, and to find permissive cell lines for further molecular and cell biological studies of this peculiar human virus For this purpose, we have cloned and sequenced the full-length genome of TTV ... SalI double-digestions of the input linear construct yielded three restriction fragments of approximately 2100, 740 and 890 bp with the first enzyme pair, andof 2200, 630 and 890 bp with the latter...
... protein kinase (DMPK) isoforms and truncation mutants Structural domain organization of DMPK splice isoforms A, C, E and F, and N-terminal and C-terminal truncation mutants of DMPK E used in this ... bly by means of its unique helical ⁄ structural properties, is a key factor in aggregation behavior and a modifier of biological propertiesof the adjacent domains (i.e the kinase and tail domains) ... to propertiesof any particular amino acid segment therein [24] We compared the localization of YFP-tagged isoforms A, C and E, containing the L477G, L487G and L515G mutations, with that of the...
... 34% between dNK and dGK [29], and 47% between dGK and dCK [28], and the structures of dNK, dGK and dCK appeared to be very similar [27,28] Despite the very low sequence identity of the cellular ... V106K, V106L, V106M, V106Q and V106T We then characterized the enzymatic propertiesof the mutant enzymes The apparent native sizes of the –ATP forms of V106WT andof the mutant recombinant enzymes ... eluted as a mixture of a dimer and a tetramer For further investigation of the role of size, conformation and polarity of amino acid 106 for the function and structure of human TK1, we created nine...