... images (a) of CdS nanowires and (b) of 1D CdS@ZnS core-shell nanocomposites the surface of the CdS nanowires ZnS nanoparticles mainly show two sets of lattice fringe spacings of 0.27 nm and 0.19 ... wider band gap (Eg = 3.7 eV) than CdS The surface modification of a wide band gap semiconducting shell around a narrow band gap core can alter the charge, functionality, and reactivity of the ... with a diameter of ca 45 nm and a length up to several tens of micrometers were coated with a uniform layer of ZnS shell This shell was composed of ZnS nanoparticles with a diameter of ca nm, anchoring...
Ngày tải lên: 22/06/2014, 01:20
... clarity As in the majority of the supramolecular syntheses, self-assembly of metal ions and ligands resulted in the formation of single, double, triple and quadruply stranded helical structures.17 ... complementary aggregation of the metal complexes Among various ligands designed and their Cu(II) and Ni(II) complexes explored in Chapter 3, only the Ni(II) complex of the chiral ligand H3Sglu, has been ... chiral ligand can often lead to the formation of helical structure.16b The presence of one or more non-chelating side arms in a chiral ligand may provide the possibility for selective and complementary...
Ngày tải lên: 15/09/2015, 17:10
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 3
... 3-16 Perspective view of III-7 When the side arm of ligand is modified by incorporating the -CONH2 donor group in the place of COO-, the mode of coordination of the ligand is different from the ... range of 670-720 nm and the ligand to metal CT bands in the range of 376-406 nm In general, the d-d transitions and charge transfer transitions occur in the range of 650-730 nm and 360-420 nm respectively ... data of III-4) The TG of III-5 and III-6 displayed the weight loss of 5.4% (calculated, 5.8%) and 5.6% (calculated, 5.4%) for the loss of three water molecules respectively Thus, besides the IR and...
Ngày tải lên: 15/09/2015, 17:10
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 2
... site of catechol oxidase from sweet potatoes (Ipomoea batatas) and in the active sites of some hemocyanins is an unusual thioether bond between a carbon atom of one of the histidine ligands and ... the activity of a series of dicopper(II) complexes containing various endogenous and exogenous bridging moieties, Mukherjee and Mukherjee reported that nature of the bridging group has profound ... Structural Properties and Catecholase Activity of Dicopper(II) Complexes of reduced Schiff base Ligands 60 Chapter (Part-A) 2-A-1 Introduction In this section, we present a series of dicopper(II)...
Ngày tải lên: 15/09/2015, 17:10
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity
... Structural Properties and Catecholase Activity of Dicopper(II) Complexes of reduced Schiff base Ligands 2-A-1 Introduction 61 2-A-2 Results and Discussion 61 2-A-2-1 Synthesis 61 2-A-2-2 Description of ... Ligands studied by Pal et al.51 In view of bacteriostatic, radioprotective, cytotoxic (inhibitor of DNA synthesis and cell growth) and antitumour properties, the chemistry of Schiff base ligands ... carboxylate and phenolic O atoms resulting in a planar conformation of the tridentate ligand 18-19 Many of the model studies of the metal complexes of Schiff base ligands composed of PLP or salicylaldehyde...
Ngày tải lên: 15/09/2015, 17:10
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... presence of minute amounts of endotoxins The comparison of LPS and MfGl-II in the LAL assay shows, as expected, activity of LPS in the range of down to 10 pgÆmL)1, whereas MfGl-II has only activity ... respectively [23,30], and the bands at Fig Infrared spectrum in the spectral range 1800–900 cm)1 (A) and – in the range of the negatively charged phosphate band mas (PO2 ) 1300– )1 1190 cm (B) of hydrated ... water-binding capacity of lecithin headgroups [30] Finally, MfGl-II exhibits a main band at 1245 cm)1 and further weak bands at 1220 and 1260 cm)1 Thus, the phosphate groups of this glycolipid are...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot
... analysis of the calculated structures revealed a short distances between NH of Leu7 and the side chain carboxyl group of the Asp6 residue (< 0.28 nm), and NH of Leu7 residue and C¼O of Leu5 (< ... of a potent endozepine antagonist (Eur J Biochem 268) 6049 Fig RP-HPLC monitoring of N- and C-terminal deprotections and on-resin cyclization of the linear precursor of cyclo128 OP Aliquots of ... the receptor affinity and selectivity of peptide ligands [13,14,27] The Ala-scan of OP has revealed that the side chain of each residue is required for the full activity of the peptide [12] These...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo khoa học: Physical properties and surface activity of surfactant-like membranes containing the cationic and hydrophobic peptide KL4 potx
... of the structural and functional properties of the native proteins and thus may offer a useful basis for the design of agents for therapeutic intervention [7] Studies of different fragments and ... Therefore, the objectives of this study were to analyze (a) the effect of KL4 on the physical properties of membranes, in the absence and presence of Ca2+, using fluorescence anisotropy of 1,6-diphenyl-1,3,5-hexatriene ... (DSC) and fluorescence confocal microscopy of giant unilamellar vesicles (GUVs), (b) the effect of the lipid composition on KL4 structure, in the absence and presence of Ca2+, using CD and (c)...
Ngày tải lên: 30/03/2014, 11:20
Protein-based surfactants synthesis, physicochemical properties, and applications
... chemical and enzymatic approaches in the synthesis of PBS In general, the book examines synthesis approaches and the physical chemistry of PBS, application potentials, and the overall state of knowledge ... conditions, as long as the status of glutamine and lysine residue dose not change However, pH affects the reactivity of the substrate proteins and the physicochemical properties of the protein conjugates ... composed of both hydrophobic and hydrophilic amino acids that afford them a certain degree of surface activity The main molecular properties of proteins responsible for their surface activity...
Ngày tải lên: 06/05/2015, 07:49
Synthesis, physical properties and biradical characters of zethrene based polycylic hydrocarbons 2
... distribution of the unpaired electrons at the zigzag edges The investigations of the anthene series have paved the way to understand the intrinsic properties of zigzag edged GNRs and the fabrications of ... for zethrene and higher order zethrenes 1.2.1 Synthesis and reactivity for zethrene-based PHs The synthesis of zethrene was pursued back to 1955 when Clar et al found a small amount of deep red ... the following part of this chapter, the synthesis, reactivity, photophysical and electrochemical properties and theoretical calculations will be discussed Figure 2.1 Structures of zethrene 2-1,...
Ngày tải lên: 10/09/2015, 09:28
Synthesis, physical properties and biradical characters of zethrene based polycylic hydrocarbons 1
... Photophysical and electrochemical properties of compounds 2-3 and 4-3 Table 5.1 Photophysical and electrochemical properties of compounds 5-1 and 5-2 ix List of Figures Figure 1.1 Examples of low band ... 2.2 (a) MALDI-TOF Mass spectrum of 2-8, (b) FT-IR spectrum of 2-3, (c) FT-IR spectrum of 2-8 Figure 2.3 Optimized molecular structures and frontier molecular orbital profiles of 2-3 and 2-8 Some ... bulb), (c) change of optical density of 2-3 and 4-3 as a function of irradiation time Figure 5.1 Resonance structures of two DBHZ isomers and chemical structures of heptazethrene, 5-1 and 5-2 Figure...
Ngày tải lên: 10/09/2015, 09:30
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA ... Characterization of /11 repressor Table Details of the oligonucleotides used Name Sequence (5¢- to 3¢) Purpose pHC1 GGATCCTAAATCTTCTTGAGTAC Synthesis of O and O1O2 DNAs Synthesis of O DNA Synthesis of O1DNA ... presence of CI More precisely, the )21 to )48 and )52 to )87 regions of the top strand and )24 to )53 and )58 to )87 regions of the bottom strand were protected by CI (Fig 3B) The centers of these...
Ngày tải lên: 07/03/2014, 00:20
Synthesis, physical properties and applications of bisanthene based near infrared dyes and semiconductors
... VIII LIST OF TABLES Table 2.1 Summary of photophysical and electrochemical properties of compounds 24, 2-5 and 2-6…………………… ………………………………………………….35 Table 3.1 Summary of photophysical and electrochemical ... cells, and sensors.3 Fundamental contributions to the directed synthesis and characterization of PAHs were pioneered by R Scholl, E Clar, and M Zander et al., who achieved the synthesis of numerous ... behavior of compound 2-4 to 2-6 were studied and the effect of the different substituents on their properties was discussed in details In addition, geometric structure and molecular packing of one of...
Ngày tải lên: 10/09/2015, 08:38
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
... the course of the winter and spring; and most of those were in the habit of A Dissertation on the Medical Properties by A McAllister 18 using ardent spirit freely And though numbers of temperate ... variety of computers including obsolete, old, middle-aged and new computers It exists because of the efforts of hundreds of volunteers and donations from people in all walks of life Volunteers and ... stupid, and wisdom to men void of understanding; capable of soothing the sorrows of the afflicted, of healing the wounds of the spirit, and assuaging the anguish of a broken heart But how it fulfils...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
... bonds between NH of Thr5 and CO of Arg2, as well as NH of Arg2 and CO of Thr5 Structure of cyclic hexapeptides – cYT peptide The NMR data of the cYT peptide were indicative of its flexible nature ... biological activity and to study the effect of reducing the chain length of peptides on Ó FEBS 2004 Design of peptides for T-cell adhesion inhibition (Eur J Biochem 271) 2879 biological activity, ... intensity of ROE cross-peaks, and were assigned as strong, medium and weak ˚ represent the family Based on ROE violation > 0.2 A and allowed values of /, w in the Ramachandran map, only one family of...
Ngày tải lên: 19/02/2014, 13:20
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... specific 5¢ -and 3¢ primers selected on the basis of the published sequences for tomato b-fructofuranosidase (GenBank accession no D11350 and S70040) Primers for the short isoform of b-fructofuranosidase ... of 50 kDa would suggest that we had purified the truncated isoform Cloning of the cDNA of two isoforms of tomato b-fructofuranosidase and recombinant expression in E coli For protein expression ... reactivity of some sera to a 9- and a 15-kDa band We could show that the 9-kDa band in the tomato extracts reacts with a specific antibody against the LTP from cherry, Pru av and the 15-kDa band...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Improving thermostability and catalytic activity of pyranose 2-oxidase from Trametes multicolor by rational and semi-rational design pdf
... head domain of up to 4.3 A, and of exposed parts of the Rossmann domain of up to 2.7 A, are observed For the rest of the homotetrameric assembly, only smaller backbone displacements of up to ... 42.3 mm)1ặcm)1) One unit of P2Ox activity was dened as the amount of enzyme necessary for oxidation of lmolặmin)1 of ABTS (which equals the consumption of lmolặmin)1 of O2) under assay conditions ... Data processing and evaluation were performed using the origin 7.5 software Crystallization, data collection and renement of the E542K and L537G mutants Crystals of the E542K, L537G and E542K L537W...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx
... [19], bone marrow [10] and several other organs [20] However, the main host cells and the target organs of this virus are still undefined The study of the biological functions of TTV is particularly ... interactions, and to find permissive cell lines for further molecular and cell biological studies of this peculiar human virus For this purpose, we have cloned and sequenced the full-length genome of TTV ... SalI double-digestions of the input linear construct yielded three restriction fragments of approximately 2100, 740 and 890 bp with the first enzyme pair, and of 2200, 630 and 890 bp with the latter...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Coiled–coil interactions modulate multimerization, mitochondrial binding and kinase activity of myotonic dystrophy protein kinase splice isoforms pptx
... protein kinase (DMPK) isoforms and truncation mutants Structural domain organization of DMPK splice isoforms A, C, E and F, and N-terminal and C-terminal truncation mutants of DMPK E used in this ... bly by means of its unique helical ⁄ structural properties, is a key factor in aggregation behavior and a modifier of biological properties of the adjacent domains (i.e the kinase and tail domains) ... to properties of any particular amino acid segment therein [24] We compared the localization of YFP-tagged isoforms A, C and E, containing the L477G, L487G and L515G mutations, with that of the...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Effect of valine 106 on structure–function relation of cytosolic human thymidine kinase Kinetic properties and oligomerization pattern of nine substitution mutants of V106 ppt
... 34% between dNK and dGK [29], and 47% between dGK and dCK [28], and the structures of dNK, dGK and dCK appeared to be very similar [27,28] Despite the very low sequence identity of the cellular ... V106K, V106L, V106M, V106Q and V106T We then characterized the enzymatic properties of the mutant enzymes The apparent native sizes of the –ATP forms of V106WT and of the mutant recombinant enzymes ... eluted as a mixture of a dimer and a tetramer For further investigation of the role of size, conformation and polarity of amino acid 106 for the function and structure of human TK1, we created nine...
Ngày tải lên: 16/03/2014, 16:20