... Carrillo-Rayas MT, Chagolla A, Gonzalez de la Vara LE: Purification and characterization of a calcium-dependent protein kinase from beetroot plasma membranes Planta 2006, 225:255-268 42 Zechmann ... relative to the inoculation site S 4A and S4B are apical proximal and basal distal regions on a systemic leaf number Noninoculated leaves are indicated as NI strands, i.e., negative genomic strands, ... Jeffers D, Noa-Carrazana JC, Ruiz-Castro S, Silva-Rosales L: Coat protein gene sequence of a Mexican isolate of Sugarcane mosaic virus and its infectivity in maize and sugarcane plants Arch Virol...
Ngày tải lên: 11/08/2014, 21:21
... device or Lab-on -a- chip has gained a lot of attention and applications in the past two decades Its broad applications in biological and chemical studies such as DNA analysis [8], cell separation [9], ... main channel During operation, small volumes of reagents can be trapped within the connecting channels and lead to contamination of the reagent flow in the mainstream channel For many applications ... was confirmed by quantitative analysis of the mixing between fluorescein and deionized water The device has potential applications in miniaturized diagnostic assays as well as in cell-based assays...
Ngày tải lên: 11/09/2015, 09:58
Báo cáo khoa học: "LANGUAGE SYNTHESIS GENERATION OF GERMAN FROM CONCEPTUAL STRUCTURE: MT PROJECT IN A JAPANESE/GERMAN" pot
... employ Winograd's terminology for functional gran~nar (Winograd, 1983) In general, case schemata will be mapped into CLAUSE-RS and concept schemata are mapped into NP-R~ A CLAUSE-RS has a features ... and labelled arcs The names of the node are called "semantic symbols" and are associated with Japanese and English dictionary entries The labelled arcs are used in two ways: a) Binary arcs either ... of COLING-80, pp.455-462 Winograd, T.: Language as a cognitive process, Addison-Wesley, 1983 McDonald, D.D.: Natural language generation as a computational problem: An Introduction; in: Brady &...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot
... carboxylic acids or an amino acid such as alanine as adenylates, which in turn are loaded to speci®c PCP domains These PCPdomains are either alone-standing PCPs, as in the biosynthesis of actinomycin ... stand-alone A- domain that activates b-lysine by adenylation It was also found that S noursei harbours a protein that after activation speci®cally binds b-lysine as a thioester This protein contains ... amino-acid recognition and their activation as an aminoacyl adenylate, and the peptidyl carrier domain (PCP-domain or T-domain) C-terminal to the A- domain providing a covalently bound 4¢-phosphopanthetheine...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... hydrazine caused the Soret absorbance peak to initially shift to 438 nm and increase in intensity then greatly diminish over several minutes, while absorbance at 500 nm decreased and absorbance at ... c552 was obtained from N europaea by D M Arciero as described earlier [22] for use as an electron acceptor in assays of hydroxylamine and hydrazine oxidation by cytochrome P460 In these assays,...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot
... of PAR4 [27] Thrombin has been shown to cleave and activate PAR1, PAR3 and PAR4, whereas trypsin cleaves and activates PAR2 As duodenase is capable of cleaving certain substrates with trypsin-like ... pathways has a modulatory rather than a mandatory role to play in mediating the proliferative response In contrast, a recent report has shown that tryptase induces DNA synthesis in canine tracheal ... PAR3 and PAR4 [11] Interestingly, thrombin has now been demonstrated to cleave and activate PAR1, PAR3 and PAR4 whereas trypsin and tryptase activate PAR2 [12] Certain other proteases, including...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khoa học: De novo RNA synthesis by a recombinant classical swine fever virus RNA-dependent RNA polymerase pot
... GTGCCATGAACAGCAGAGATTTTTATAC TAGCCATGCCCATAGTAGG ATCAGGTCGTACTCCCATCAC TAATACGACTCACTATAGCGCGGGTAAC GCGCGGGTAACCCGGGATCTGAA GGGCCGTTAGGAAATTACCTTAGTC CGGCCGTTAGGAAATTACCTTAGTC TGGCCGTTAGGAAATTACCTTAGTC AGGCCGTTAGGAAATTACCTTAGTC ... ATCAGGAGACCAGCAGCCCCGCACACAT ATGTGTGCGGGGCTGCTGGTCTCCTGAT GTATACGAGGTTAGTTCATTC CTATACGAGGTTAGTTCATTC TTATACGAGGTTAGTTCATTC ATATACGAGGTTAGTTCATTC TAATACGACTCACTATAGGGTGCCATGAA CAG GTGCCATGAACAGCAGAGATTTTTATAC ... the additional polyhistidine amino acid sequences are underlined Primers Sequence (5¢)3¢) NS5BFor NS5BRev CATGCCATGGGCAGTAATTGGGTGATGCA GAAGATCTTAATGATGATGATGATGATG GCTGCCATTGTACCTGTCTGCCCCTT ATCAGGAGACCAGCAGCCCCGCACACAT...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... the treated animals to measure the biochemistry markers including alanine transaminase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatine (Cr) using commercial kits ... transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; Cr: Creatinine Acknowledgements This work was supported by grants ... were measured at the indicated time points after intratumoral injection with AdCMV(-), AdhTERTHRP, AdCMVmIL-12 alone or in combination Each data point represented the mean tumor volume in that group...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx
... Utilization of a mammalian cell-based RNA binding assay to characterize the RNA binding properties of picornavirus 3C proteinases RNA 1998, 4(2):215-225 Hammerle T, Molla A, Wimmer E: Mutational analysis ... affinity binding determinants are located in the 3Dpol domain [27,28] We have recently shown that a mutation (3CproR8 4A/ I8 6A) in the RNA binding domain of 3CDpro abolishes that ability of the protein ... of a viral RNA template (Figs 2B and 2C, lane 3) When 3CDpro mRNA, containing the R84S/I8 6A mutations in the RNA binding domain of 3Cpro, was cotranslated with the input viral RNA no stimulation...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc
... the treated animals to measure the biochemistry markers including alanine transaminase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatine (Cr) using commercial kits ... transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; Cr: Creatinine Acknowledgements This work was supported by grants ... were measured at the indicated time points after intratumoral injection with AdCMV(-), AdhTERTHRP, AdCMVmIL-12 alone or in combination Each data point represented the mean tumor volume in that group...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo hóa học: " Research Article Electroelastic Wave Scattering in a Cracked Dielectric Polymer under a Uniform Electric Field" doc
... unknowns A1 a α , A2 a α are related to the new one Aa α through A1 a α − 2α2 − γ1 α p/c2 p c2 Aa α E0 2A1 μ ε0 η α2 aa α , 4.39 − A2 a α p/c2 E0 A2 αaa α 2αAa α − μ The unknowns Aa α and aa α can be ... solutions a , ϕea , ψea and a are a ϕea π ∞ − aa α e−αy sin αx dα, 4.30 c2 p A2 a α e−γ2 αy A1 a α e−γ1 αy ψea ∞ π π ∞ a − π E0 2A1 μ − c2 p A2 A3 αaa α e−αy E0 A2 αaa α e−αy μ sin αx dα, cos ... aa α cosh αy sin αx dα, 4.32 12 Boundary Value Problems where aa α , A1 a α , A2 a α , and aa α are unknown functions The displacements and stresses are obtained as uxa π ∞ A1 a α e−γ1 c2 p uya...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt
... TGGCTGTTTCTGGCTGTTACTG and AATCAGCAGCGACTCCTTTTCC; IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC; β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGATGTCACGCACGATTTCC Statistical analysis ... Laboratory Animal Center (Shizuoka, Japan) All mice were maintained in a pathogen-free facility at the Hyogo College of Medicine Animal experiments were done in accordance with the guidelines of the National ... Tomita N, Moriguchi A, Maeda K, Sawa Y, Kaneda Y, Higaki J, et al.: In vivo transfection of cis element "decoy" against nuclear factor-κB binding site prevents myocardial infarction Nat Med 1997, 3:894-899...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Prostaglandin E2 synthesis in cartilage explants under compression: mPGES-1 is a mechanosensitive gene" docx
... 5'-gctggtgaaaaggacctct-3' 5'-cacaggactagaacacctgc-3' 249 COX-1 58 BC005573 5'-ctttgcacaacacttcacccacc-3' 5'-agcaacccaaacacctcctgg-3' 285 COX-2 58 NM_011198 5'-gcattctttgcccagcactt-3' 5'-agaccaggcaccgaccaaaga-3' ... Wachtmann TS, Umland JP, Pandher K, Lapointe JM, Saha S, Roach ML, et al.: Impaired inflammatory and pain responses in mice lacking an inducible prostaglandin E synthase Proc Natl Acad Sci USA 2003, 100:9044-9049 ... 100:9044-9049 Kamei D, Yamakawa K, Takegoshi Y, Mikami-Nakanishi M, Nakatani Y, Oh-Ishi S, Yasui H, Azuma Y, Hirasawa N, Ohuchi K, et al.: Reduced pain hypersensitivity and inflammation in mice lacking...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line" pptx
... purchased from Ambion (Austin, TX) The coding strand for PARP-1 siRNA was 5’-AUG UCG GCA AAG UAG AUC CCU UUC C-3’ An unrelated siRNA sequence (catalog number 12935-113) was used as a control In ... shock and evaluated DNA binding of HSF1 by EMSA After heat shock, both naïve and non-target siRNA transfected cells demonstrated comparable DNA binding activity of HSF-1 Using EMSA, we found that ... Wheeler DS, Malhotra V, et al: A green tea-derived polyphenol, epigallocatechin-3-gallate, inhibits IkappaB kinase activation and IL-8 gene expression in respiratory epithelium Inflammation 2002,...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: " Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line." pptx
... purchased from Ambion (Austin, TX) The coding strand for PARP-1 siRNA was 5’-AUG UCG GCA AAG UAG AUC CCU UUC C-3’ An unrelated siRNA sequence (catalog number 12935-113) was used as a control In ... shock and evaluated DNA binding of HSF1 by EMSA After heat shock, both naïve and non-target siRNA transfected cells demonstrated comparable DNA binding activity of HSF-1 Using EMSA, we found that ... Wheeler DS, Malhotra V, et al: A green tea-derived polyphenol, epigallocatechin-3-gallate, inhibits IkappaB kinase activation and IL-8 gene expression in respiratory epithelium Inflammation 2002,...
Ngày tải lên: 11/08/2014, 06:22
báo cáo khoa học: " Resistance to Plasmopara viticola in a grapevine segregating population is associated with stilbenoid accumulation and with specific host transcriptional responses" doc
... ((+)-E-ε-viniferin, Z- and E-ω-viniferin, ampelopsin D and quadrangularin A) , trimers (Z-miyabenol C and E-miyabenol C and aviniferin) and tetramers (isohopeaphenol, ampelopsin H and vaticanol-C-like ... obtained by blastn/x against EST database at NCBI [70], DFCI Grape Gene Index [71], IASMA Grape Genome database (release 3.0) [72], RefSeq database [73] and UNIPROT database [74] Additional file ... this article as: Malacarne et al.: Resistance to Plasmopara viticola in a grapevine segregating population is associated with stilbenoid accumulation and with specific host transcriptional responses...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
... Nemeckova S, Hainz P, Otahal P, Gabriel P, Sroller V, Kutinova L: Early gene expression of vaccinia virus strains replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) ... (CRL-1573) Rat/small intestine; normal Hamster syrian/kidney; normal Human/colon; colorectal adenocarcinoma Rat/liver; hepatoma Human/small intestine; normal Human/duodenum; adenocarcinoma African Green ... glutinin viral Cellularprotein localization of the influenza virus haemagCellular and viral localization of the influenza virus haemagglutinin protein Vero cells were infected with MVA-HANP and HA...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx
... new HA and/or NA subtype into human population All known HA and NA subtypes are maintained in avian species, and all mammalian influenza A viruses are thought to be derived from the avian influenza ... according to hosts, subtypes, geographical information, or temporal information using FigTree (ver.1.1.2) Dataset of Influenza for Each Host Datasets for each host (avian, canine/equine, human, ... human and swine influenza may make human and swine influenza evolve more rapidly than avian influenza (Figures and 3) Interestingly, evolutionary rates were significantly different between lineages...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps
... Nemeckova S, Hainz P, Otahal P, Gabriel P, Sroller V, Kutinova L: Early gene expression of vaccinia virus strains replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) ... (CRL-1573) Rat/small intestine; normal Hamster syrian/kidney; normal Human/colon; colorectal adenocarcinoma Rat/liver; hepatoma Human/small intestine; normal Human/duodenum; adenocarcinoma African Green ... glutinin viral Cellularprotein localization of the influenza virus haemagCellular and viral localization of the influenza virus haemagglutinin protein Vero cells were infected with MVA-HANP and HA...
Ngày tải lên: 12/08/2014, 04:21