symptoms of head and neck cancer caused by hpv
Báo cáo khoa học: "Reirradiation of head and neck cancer focusing on hypofractionated stereotactic body radiation therapy" pdf
... Ang KK: Final report of RTOG 9610, a multi- institutional trial ofreirradiation and chemotherapy for unresectable recurrent squamous cell carcinoma of the head and neck. Head Neck 2008, 30:281-8. ... Williamson SK, Von Hoff DD: Randomized comparison of cisplatin plus fluorouracil and carboplatin plus fluorouracil versus methotrexate in advanced squamous-cell carcinoma of the head and neck: a Southwest ... Radiotherapy for Locally Recurrent Head- and- Neck Tumors. Int J Radiat Oncol Biol Phys . 14. Langlois D, Eschwege F, Kramar A, Richard JM: Reirradiation of the head and neck cancers. Radiother Oncol 1985,
Ngày tải lên: 09/08/2014, 09:21
Báo cáo y học: "Systems biology-defined NF-κB regulons, interacting signal pathways and networks are implicated in the malignant phenotype of head and neck cancer cell lines differing in p53 status" pps
... properly cited. NF-?B regulons involved in head and neck cancer& lt;p>Detailed analysis of NFkB regulons in 1,265 genes differentially expressed in head and neck cancer cell lines differing in p53 ... angiogenesis, immune and proinflammatory responses, and therapeutic resistance in head and neck squa- mous cell carcinoma (HNSCC) and other cancers [3-5]. How- ever, nuclear activation of hetero- and homodimers ... Stoeckert ‡¥ and Zhong Chen * Addresses: * Head and Neck Surgery Branch, NIDCD, National Institutes of Health, Bethesda, MD 20892, USA. † Department of Bioengineering, Smith Walk; University of Pennsylvania,
Ngày tải lên: 14/08/2014, 08:20
Regular recreational physical activity and risk of head and neck cancer
... carcinoma of the head and neck, including cancers of the oral cavity, oropharynx, hypopharynx, and larynx; 2) no history of any type of cancer diagnosis; and 3) between the age of 20 and 80 Controls ... reduction of colon cancer, breast cancer, and endometrial cancer by PA, while the evidence for other cancers is limited [6, 7] PA may have the potential to influence HNC risk by modulating the level of ... stated Lin et al BMC Cancer (2017) 17:286 Background Head and neck cancer (HNC) (cancers of the oral cavity, oropharynx, hypopharynx, and larynx) is the fifth leading cancer in the world, with
Ngày tải lên: 19/09/2020, 21:40
Evaluation of hypoxia in a feline model of head and neck cancer using 64Cu-ATSM positron emission tomography/computed tomography
... Ballegeer et al BMC Cancer 2013, 13:218 http://www.biomedcentral.com/1471-2407/13/218 RESEARCH ARTICLE Open Access Evaluation of hypoxia in a feline model of head and neck cancer using 64Cu-ATSM ... middle, and transverse plane on the right A similar area of transection through the head in each plane was chosen between two time points, using anatomic landmarks of the orbit, mandibular rami, and ... The location of the mass, maximum dimension of the mass, Tmax/M, Tav/M and pO2 in three tumor regions are provided HNSCC = head and neck squamous cell carcinoma Ballegeer et al BMC Cancer 2013,
Ngày tải lên: 05/11/2020, 06:22
parathyroid hormone like hormone is a poor prognosis marker of head and neck cancer and promotes cell growth via runx2 regulation
... proliferation, and differentiation in endochondral bone formation process13,14 and is an important transcription factor in breast and prostate cancer development and progression15 In breast cancer cells and ... trait of cancer cells is the uncontrolling cell growth1 Cancer cells harbor numerous genetic changes to maintain proliferation abilities and resist cell death signals or growth suppressors Head and ... Taipei, Taiwan 4Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan Department of Otolaryngology, Head and Neck Collaborative Oncology Group,
Ngày tải lên: 04/12/2022, 15:59
Báo cáo khoa học: " Clinical-dosimetric analysis of measures of dysphagia including gastrostomy-tube dependence among head and neck cancer patients treated definitively by intensity-modulated radiotherapy with concurrent chemotherapy" pdf
... for head and neck carcinoma. Oncologist 2007, 12:565-8. 5. Rosenthal DI, Lewin JS, Eisbruch A: Prevention and treatment of dysphagia and aspiration after chemoradiation for head and neck cancer. ... Newman LA, Liu D: Site of disease and treatment protocol as correlated of swal- lowing function in patients with head and neck cancer treated with chemoradiaiton. Head Neck 2006, 28:64-73. 31. ... with head and neck cancer. Head Neck 2000, 22:474-82. 37. Stenson KM, MacCracken E, List M, Haraf DJ, Brockstein B, Weich- selbaum R, Vokes EE: Swallowing function in patients with head and neck
Ngày tải lên: 09/08/2014, 10:20
Comparative effectiveness trial of transoral head and neck surgery followed by adjuvant radio(chemo)therapy versus primary radiochemotherapy for oropharyngeal cancer (TopROC)
... Department of Otorhinolaryngology and Head and Neck Surgery, University Medical Center Hamburg Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany 2Department of Otorhinolaryngology and Head and Neck ... in locally advanced head and neck cancers: a comparative analysis of concurrent postoperative radiation plus chemotherapy trials of the EORTC (#22931) and RTOG (# 9501) Head Neck 2005;27(10):843–50 ... predicting and detecting early response to chemoradiation therapy of squamous cell carcinomas of the head and neck Clin Cancer Res 2009;15(3):986–94 37 Vandecaveye V, De Keyzer F, Vander Poorten
Ngày tải lên: 06/08/2020, 05:33
HSP90 inhibition sensitizes head and neck cancer to platin-based chemoradiotherapy by modulation of the DNA damage response resulting in chromosomal fragmentation
... KLN, CMN and KJH were funded by Cancer Research UK Programme Grant A13407 AAK was funded by the Wellcome Trust MM and MP were funded by the Oracle Cancer Trust MD was funded by CRUK and The Rosetrees ... ability of AUY922 to sensitize to CCRT was assessed in p53 mutant head and neck cell lines by clonogenic assay Modulation of the CCRT induced DNA damage response (DDR) by AUY922 was characterized by ... sensitization by AUY922 The addition of AUY922 to cisplatin, radiation and CCRT combinations was shown to be synergistic across a panel of p53mt AUY922 and was capable of enhancing the efficacy of CCRT
Ngày tải lên: 20/09/2020, 01:18
Báo cáo khoa học: "Parotid gland sparing IMRT for head and neck cancer improves xerostomia related quality of life" doc
... Oncology, The Netherlands Cancer Institute - Antoni van Leeuwenhoek Hospital, Amsterdam, The Netherlands, 3 Department of Head and Neck Oncology and Surgery, The Netherlands Cancer Institute - ... field study of the EORTC QLQ-C30 (version 3.0) and the head and neck can- cer specific module (EORTC QLQ-H&N35) in head and neck patients. EORTC Quality of Life Group. Eur J Cancer 2000, ... Jannert M, Westin T, Kaasa S: Quality of life in head and neck cancer patients: val- idation of the European Organization for Research and Treatment of Cancer Quality of Life Questionnaire-H&N35.
Ngày tải lên: 09/08/2014, 09:22
Dietary-phytochemical mediated reversion of cancer-specific splicing inhibits Warburg effect in head and neck cancer
... expression of BORIS in (d) Ye Head- Neck and (e) Slebos Head- Neck cancer analyzed by using Oncomine database (f) Western blot showing the protein level of PKM2, PKM1, and BORIS in paired normal and tumor ... and lactate production and thereby reduced growth, invasion and increased apoptosis of head- and- neck cancer cells The observed effect of curcumin on alternative splicing of PKM gene together with ... study highlights the potential of nutraceuticals in reversion of cancer- specific splicing and thereby may provide avenues for therapeutic management of head and neck cancer in the future Conclusion
Ngày tải lên: 17/06/2020, 18:58
Feasibility and acceptability of combining cognitive behavioural therapy techniques with swallowing therapy in head and neck cancer dysphagia
... Research and Treatment of Cancer – Head and Neck module; EORTC-QLQ: European Organization for Research and Treatment of Cancer- Quality of Life Questionnaire; HADS: Hospital Anxiety and Depression ... development and validation of a dysphagia-specific quality -of- life questionnaire for patients with head and neck cancer: the M D Anderson dysphagia inventory Archives of Otolaryngol Head Neck Surg ... Lefebvre JL Best practices in the management of the psycho-oncologic aspects of head and neck cancer patients: recommendations from the European head and neck cancer society make sense campaign Ann
Ngày tải lên: 23/07/2020, 23:44
Progressive resistance training in head and neck cancer patients during concomitant chemoradiotherapy – design of the DAHANCA 31 randomized trial
... Denmark (protocol id: H-15003725) and registered retrospectively at ClinicalTrials.gov (NCT02557529) September 11th 2015 Keywords: Head and neck cancer, Head and neck squamous cell carcinoma, Chemoradiotherapy, ... At the Departments of Oncology at Herlev and Aarhus University Hospitals, patients with stage III/IV squamous cell carcinoma of the head and neck, scheduled for CCRT are randomized 1:1 to either ... 31 randomized trial Camilla K Lonkvist1, Simon Lønbro2,3, Anders Vinther4, Bo Zerahn5, Eva Rosenbom6, Hanne Primdahl7, Pernille Hojman8 and Julie Gehl1* Abstract Background: Head and neck cancer
Ngày tải lên: 06/08/2020, 07:25
Swallowing interventions for the treatment of dysphagia after head and neck cancer: A systematic review of behavioural strategies used to promote patient adherence to swallowing exercises
... swallowing interventions, and to explore any relationships between these strategies and intervention effects Randomised and quasi-randomised studies of head and neck cancer patients were included ... EORTC: European Organisation of Research and Treatment of Cancer; FOIS: Functional oral intake scale; HNC: Head and neck cancer; MBS: Modified barium swallow; MDADI: MD Anderson Dysphagia Inventory; ... Normalcy of food intake in patients with head and neck cancer supported by combined dietary counseling and swallowing therapy: A randomised clinical trial Head Neck 2015 doi:10.1002/hed 35 Lazarus
Ngày tải lên: 20/09/2020, 01:02
Molecular analyses of unselected head and neck cancer cases demonstrates that human papillomavirus transcriptional activity is positively associated with survival and prognosis
... S The prevalence of human papillomavirus in oropharyngeal and nonoropharyngeal head and neck cancer: a systematic review and meta-analysis of trends by time and region Head Neck 2013;35:747–55 ... difference in the mean age, irrespective of the method of HPV detection used, between HPV- positive and HPV- negative patients mixed sequencing traces HPV 11, HPV 26 and HPV 40 were each found on one occasion ... fraction of HPV- positive head and neck cancers increases, this may highlight the importance of understanding the underlying mechanisms responsible for oncogenesis and the differences between HPV- related
Ngày tải lên: 21/09/2020, 01:35
Proteoglycan-based diversification of disease outcome in head and neck cancer patients identifies NG2/CSPG4 and syndecan-2 as unique relapse and overall survival predicting factors
... University Hospital in Bologna and at the Maxillo-Facial Surgery Division, Department of Head and Neck Surgery of the University of Parma A total of 173 surgical specimens of primary oral cavity HNSCC ... by a variable expression of all PGs and a characteristic de novo transcription/translation of GPC2, GPC5 and NG2/ CSPG4 respectively in 36%, 72% and 71% on 119 cases Importantly, expression of ... confer metastatic potential to cancer cells by serving as a multivalent mediator of the cancer cell-host microenvironment interactions and by enhancing drug resistance and protecting cells from stress-induced
Ngày tải lên: 29/09/2020, 16:16
Diagnostic value of retrospective PET-MRI fusion in head-and-neck cancer
... type and extent of surgical resection of the tumour and the type of the neck dissection was determined by our head- and- neck surgical team on the basis of staging results and estimated risk of occult ... PET and of MRI alone for locoregional tumour and nodal staging of head- and- neck cancer Methods: Thirty-three patients with head- and- neck cancer underwent preoperative contrast-enhanced MRI and PET/ ... Retrospective image fusion, Side -by- side analysis, Head- and- neck cancer, Staging Background Clinical examination and imaging is routinely performed for the staging of head- and- neck cancer (HNC) in order
Ngày tải lên: 30/09/2020, 15:04
focal overexpression of ceacam6 contributes to enhanced tumourigenesis in head and neck cancer via suppression of apoptosis
... Background: Overexpression of CEACAM6 has been reported for a number of malignancies However, the mechanism of how CEACAM6 contributes to cancer formation and its role in head and neck squamous cell ... top strand and bottom strand was 5’ GTCAATAGTGAGTGGCAGTG 3’ The other miR RNAi sequence for CEACAM6 was named miR CEA Dux, with a top strand of 5’ CCGGACAGTTCC ATGTATACC 3’ and bottom stand of 5’ ... field of view by NIS-Elements BR3.1 imaging software Quantification of cleaved caspase expression (D) was estimated as number of positive cells per field of view by NIS-Elements BR3.1 imaging software
Ngày tải lên: 02/11/2022, 10:46
Tài liệu Diagnosis and management of head and neck cancer docx
... of symptoms suggestive of head and neck cancer. 3.2 DIAGNOSIS AND STAGING Diagnosis and staging of head and neck malignancy will normally include clinical examination by anexperiencedclinician,breopticendoscopy,neneedleaspiration(FNA)/corebiopsy of any ... practitioners, should be aware of the presenting features of head and neck cancer, and the local referral pathways for suspected cancers. 2.5 SCREENING FOR HEAD AND NECK CANCER There is no evidence ... informationleaetabout head and neck cancer hadincreasedawareness of riskcomparedto patientswhohadnotseentheleaet.Aquestionnaire of awareness of signs and symptoms and risks of oral cancer showedthatallthosewhoreceivedtheleaet(smokers,non-smokers and...
Ngày tải lên: 14/02/2014, 22:20
Pocket Guide To TNM STAGING OF HEAD AND NECK CANCER AND NECK DISSECTION CLASSIFICATION pdf
... Guide to NECK DISSECTION CLASSIFICATION AND TNM STAGING OF HEAD AND NECK CANCER Committee for Head and Neck Surgery and Oncology American Academy of Otolaryngology– Head and Neck Surgery Neck Dissection ... of: Pocket guide to neck dissection classification and TNM staging of head and neck cancer / Committee for Neck Dissection Classification, American Head and Neck Society [and] Committee for Head and ... Sharma, Anand K. IV. Kies, Merrill S. V. American Academy of Otolaryngology Head and Neck Surgery. Committee for Head and Neck Surgery and Oncology. VI. American Head and Neck Society. Neck Dissection...
Ngày tải lên: 15/03/2014, 00:20