studying mucin secretion from human bronchial epithelial cell primary cultures

Báo cáo y học: "Pneumocystis cell wall β-glucan stimulates calcium-dependent signaling of IL-8 secretion by human airway epithelial cells" ppt

Báo cáo y học: "Pneumocystis cell wall β-glucan stimulates calcium-dependent signaling of IL-8 secretion by human airway epithelial cells" ppt

... optimal secretion of IL-8 by airway epithelial cells stimulated with PCBG requires intra-cellular, rather than extra-cellular, calcium mobilization IL-8 secretion by airway epithelial cells is ... airway epithelial cells following stimulation with PCBG IL-8 secretion by PCBG stimulated airway epithelial cells is mediated by MAP Kinases Figure PCBG induces IL-8 release from 1HAEo- human ... carbohydrate-rich cell wall fraction is capable of inducing specific chemokines and cytokines in cells such as macrophages, dendritic cells (DC) and alveolar epithelial cells [11,12,17,18] Airway epithelial cells...

Ngày tải lên: 12/08/2014, 11:22

12 238 0
Báo cáo y học: " Cryptococcus neoformans induces IL-8 secretion and CXCL1 expression by human bronchial epithelial cells" doc

Báo cáo y học: " Cryptococcus neoformans induces IL-8 secretion and CXCL1 expression by human bronchial epithelial cells" doc

... diluted to the desired concentration in cell culture media Cells and culture conditions The BEAS-2B human tracheobronchial epithelial cell line was obtained from the ATCC (CRL-9609) and cultured ... the figure legends NHBE (Normal Human Bronchial Epithelial) cells from Cambrex (Walkersville, MD) were maintained at 37°C and 5% CO2 and subcultured in Bronchial Epithelial Growth Medium (BEGM) ... CAAT/enhancer-binding protein beta (CEBP/β) Primary Normal Human Bronchial Epithelial cells also secreted more IL-8 and exhibited significantly greater cell damage in response to acapsular C neoformans...

Ngày tải lên: 12/08/2014, 15:21

12 304 0
Báo cáo y học: " Mechanical compression attenuates normal human bronchial epithelial wound healing" pot

Báo cáo y học: " Mechanical compression attenuates normal human bronchial epithelial wound healing" pot

... may retard epithelial migration and wound healing in the airway, thus promoting a pro-fibrotic state during chronic asthma Methods Cell Culture Passage normal human bronchial epithelial cells (NHBE) ... normal human tracheobronchial epithelial cells Am J Respir Cell Mol Biol 1996, 14(1):104-112 Swartz MA, Tschumperlin DJ, Kamm RD, Drazen JM: Mechanical stress is communicated between different cell ... (compression),cells cells that underwent both a scrape (A) Active TGF-2, (B), Et-1, (C) EGF, and (D) PGE2 media content for unstimulated cells (control), cells that underwent a scrape wound (scrape), cells...

Ngày tải lên: 12/08/2014, 14:20

12 145 0
Báo cáo y học: " Anti-inflammatory effects of antibacterials on human bronchial epithelial cells" pdf

Báo cáo y học: " Anti-inflammatory effects of antibacterials on human bronchial epithelial cells" pdf

... Methods Preparation of air-liquid interface cultures of human bronchial epithelial cells (hu-BEC) The human bronchial epithelial cells were harvested from patients undergoing lung surgery for cancer ... air-liquid-interface (ALI) cultures with buffer or with cefuroxime (62.5 mg/l), azi- Therefore, we investigated the modulation of cytokine release from primary human bronchial epithelial cells in air-liquid ... the epithelial cells Then the cells were grown to 80% confluence with airway epithelial cell growth medium (Promocell, Germany) and after treatment with trypsin (0.05%, Invitrogen, USA) the cells...

Ngày tải lên: 12/08/2014, 14:20

8 294 0
Báo cáo y học: " TGF-β1 induced epithelial to mesenchymal transition (EMT) in human bronchial epithelial cells is enhanced by " pot

Báo cáo y học: " TGF-β1 induced epithelial to mesenchymal transition (EMT) in human bronchial epithelial cells is enhanced by " pot

... EMT markers in primary normal human bronchial epithelial cells Since BEAS-2B cells are a transformed human bronchial epithelial cell line, we then assessed whether primary NHBE cells also undergo ... EMT-marker proteins in primary human bronchial epithelial cells (NHBE) TGFβ1 TGFβ1 increases the mRNA of EMT-marker proteins in primary human bronchial epithelial cells (NHBE) A: NHBE cells were stimulated ... in primary normal human bronchial epithelial cells (NHBE) These results establish that TGFβ-induced EMT is not limited to alveolar epithelial cells but can also be induced in normal human bronchial...

Ngày tải lên: 12/08/2014, 14:20

15 272 0
Báo cáo y học: " Upregulation of pirin expression by chronic cigarette smoking is associated with bronchial epithelial cell apoptosis" ppsx

Báo cáo y học: " Upregulation of pirin expression by chronic cigarette smoking is associated with bronchial epithelial cell apoptosis" ppsx

... CAGCCCATGGCCTACAACTGTGGGTTATA Exposure of Primary Human Bronchial Epithelial Cells to Cigarette Smoke Extract Three separate primary human bronchial epithelial (HBE) cell cultures were isolated from trachea and bronchi ... up-regulates pirin expression in human bronchial epithelium, primary human bronchial epithelial cells were exposed to cigarette smoke extract in vitro Human bronchial epithelial cells were used, as they ... quantitative PCR in human bronchial epithelial (HBE) cells exposed to varyMean RNA expression levels for pirin assessed by quantitative PCR in human bronchial epithelial (HBE) cells exposed to varying...

Ngày tải lên: 12/08/2014, 15:20

13 246 0
Báo cáo y học: "Staphylococcus aureus enterotoxins induce IL-8 secretion by human nasal epithelial cells" potx

Báo cáo y học: "Staphylococcus aureus enterotoxins induce IL-8 secretion by human nasal epithelial cells" potx

... accessory cell function in respiratory epithelial cells Am J Respir Cell Mol Biol 1999, 21:365-379 Saunders NA, Smith RJ, Jetten AM: Differential responsiveness of human bronchial epithelial cells, ... graph cells derived from asthmatic subjects compared to cells derived from normal subjects at and 24 h (p = 0.02 and 0.01 respectively) The median values of IL-8 release from asthmatic cell cultures ... obtained from unstimulated cells and cells stimulated with enterotoxins IL-8 was present in cell lysates from stimulated cells and was not detected in lysates from unstimulated cultures TNF-α, RANTES...

Ngày tải lên: 12/08/2014, 16:20

11 294 0
Báo cáo y học: " Mechanism of cigarette smoke condensate-induced acute inflammatory response in human bronchial epithelial cells" docx

Báo cáo y học: " Mechanism of cigarette smoke condensate-induced acute inflammatory response in human bronchial epithelial cells" docx

... release from human bronchial epithelial cells Am J Respir Crit Care Med 1997, 155:1770-6 Nakamura H, Yoshimura K, Jaffe HA, Crystal RG: Interleukin-8 gene expression in human bronchial epithelial cells ... in human airway epithelial cells via NF-kappaB activation Am J Respir Cell Mol Biol 1998, 19:98106 17 Carter JD, Ghio AJ, Samet JM, Devlin RB: Cytokine production by human airway epithelial cells ... smoke and house dust mite allergens on inflammatory mediator release from primary cultures of human bronchial epithelial cells Clin Exp Allergy 2001, 31:226-38 Mio T, Romberger DJ, Thompson AB,...

Ngày tải lên: 12/08/2014, 18:20

8 269 0
Báo cáo khoa học: The heterogeneity of mast cell tryptase from human lung and skin Differences in size, charge and substrate affinity ppt

Báo cáo khoa học: The heterogeneity of mast cell tryptase from human lung and skin Differences in size, charge and substrate affinity ppt

... Materials and methods Isolation of lung mast cells Human lung mast cells were isolated as described previously [39] Briey, cells from macroscopically normal human lung tissue (obtained through surgical ... that the purity of mast cells thus obtained ranged from 65% to 95% of all nucleated cells Isolation of skin mast cells Mast cells were isolated as described previously from infant foreskin tissue ... 2003 Heterogeneity of human mast cell tryptase (Eur J Biochem 270) 271 Initially, four different cDNA sequences were identied, a- and b-tryptase from a human lung mast cell library [26,27] and...

Ngày tải lên: 31/03/2014, 07:20

14 438 0
báo cáo hóa học:" Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels" docx

báo cáo hóa học:" Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels" docx

... Figure Cell proliferation kinetics of vascular cell types obtained from human umbilical cords (UCs) Cell proliferation kinetics of vascular cell types obtained from human umbilical cords (UCs) Human ... calculated HUAECs (Figure 4A, average of cells from 11 individuals from each group) and HUVECs (Figure 4B, average of cells from individuals from each group) from both birth weight groups showed ... Subconfluent cultures were split 1:3 When required, cell number was calculated by counting harvested cells using a hemocytometer chamber Cell viability and cellular proliferation Passage 2–4 cells were...

Ngày tải lên: 18/06/2014, 15:20

10 432 0
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

... gated on CD4+ T cells Percentage of cells from parental gate is indicated in each quadrant b) Increased ratio of NK:FoxP3high T cells during 3a-G1 driven expansion of human NK cells from PBMCs Page ... of human NK cells from IL-2 treated PBMCs [29] We have shown that depleting monocytes from PBMCs prevents CD4+ T cell proliferation In agreement with Miller's report, we also found that NK cells ... high yield expansion human NK cells from PBMCs [22] Expanded NK cells are fully functional and can efficiently lyse a broad spectrum of tumor cell lines Prospecting the transfer from bench to clinic...

Ngày tải lên: 18/06/2014, 15:20

13 404 0
Báo cáo sinh học: " Kinetics of antibody-induced modulation of respiratory syncytial virus antigens in a human epithelial cell line" docx

Báo cáo sinh học: " Kinetics of antibody-induced modulation of respiratory syncytial virus antigens in a human epithelial cell line" docx

... concentration of RSV Ag-Abs in cell surface and in intra-cellular viral proteins Moreover, antiRSV IgG protected HEp-2 cells from viral-induced cell death Methods All reagents were from Sigma, unless otherwise ... were from Sigma, unless otherwise specified Virus and cells Human epidermoid carcinoma larynx cell line HEp-2 from our laboratory (originally from ATCC) was grown in Dulbecco's modified medium (D-MEM; ... immunofluorescence of RSV antigen in infected epithelial cells Indirect Indirect immunofluorescence of RSV antigen in infected epithelial cells Viral proteins in HEp-2 cells, which had been infected at m.o.i...

Ngày tải lên: 18/06/2014, 18:20

9 403 0
Báo cáo hóa học: " Kinetics of antibody-induced modulation of respiratory syncytial virus antigens in a human epithelial cell line" pot

Báo cáo hóa học: " Kinetics of antibody-induced modulation of respiratory syncytial virus antigens in a human epithelial cell line" pot

... concentration of RSV Ag-Abs in cell surface and in intra-cellular viral proteins Moreover, antiRSV IgG protected HEp-2 cells from viral-induced cell death Methods All reagents were from Sigma, unless otherwise ... were from Sigma, unless otherwise specified Virus and cells Human epidermoid carcinoma larynx cell line HEp-2 from our laboratory (originally from ATCC) was grown in Dulbecco's modified medium (D-MEM; ... immunofluorescence of RSV antigen in infected epithelial cells Indirect Indirect immunofluorescence of RSV antigen in infected epithelial cells Viral proteins in HEp-2 cells, which had been infected at m.o.i...

Ngày tải lên: 20/06/2014, 01:20

9 330 0
Báo cáo hóa học: " Respiratory syncytial virus glycoproteins uptake occurs through clathrin-mediated endocytosis in a human epithelial cell line" docx

Báo cáo hóa học: " Respiratory syncytial virus glycoproteins uptake occurs through clathrin-mediated endocytosis in a human epithelial cell line" docx

... envelope proteins in Hep-2 cells Endocytosis of RSV envelope proteins in Hep-2 cells Hep-2 cells were infected with RSV at a multiplicity of infection of After 12 h, the cells were incubated with ... microscopy For this purpose, HEp-2 cells were RSV infected for 12 h Origin of cells, virus propagation and infection procedures were previously reported [8] The infected cells were washed and incubated ... mechanism [8] With the aim to confirm whether internalization of RSV cell surface antigen-antibody complexes in epithelial cells occurs through clathrin, the present study was undertaken The uptake...

Ngày tải lên: 20/06/2014, 01:20

4 231 0
Báo cáo hóa học: " Characteristics of functionalized nanohydroxyapatite and internalization by human epithelial cell" pdf

Báo cáo hóa học: " Characteristics of functionalized nanohydroxyapatite and internalization by human epithelial cell" pdf

... shown) Cell toxicity of Arg-Eu-HAP The effect of varying concentrations and exposure time of Arg-Eu-HAP on cell toxicity was evaluated using human epithelial lung cancer cell line (A549) The cell ... Page of Figure Cell viability assay Cell viability assay showing the effect of varying concentrations of nanoparticles on growth inhibition of human lung epithelial (A549) cancer cells cultured ... using flow cytometry in human lung epithelial (A549) cell Yan-zhong et al Nanoscale Research Letters 2011, 6:600 http://www.nanoscalereslett.com/content/6/1/600 line In brief, cells were seeded in...

Ngày tải lên: 20/06/2014, 22:20

8 343 0
Báo cáo y học: "Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers" docx

Báo cáo y học: "Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers" docx

... migration of primary human mesenchymal progenitor cells J Cell Biochem 2002, 87:305-312 Cheng SL, Yang JW, Rifas L, Zhang SF, Avioli LV: Differentiation of human bone marrow osteogenic stromal cells ... cartilage cells To study the possible multilineage capacity of some OC derived cells, we differentiated these cell cultures toward the osteogenic, adipogenic and chondrogenic lineages Pellet cultures ... from human bone marrow Stem Cells 2002, 20:249-258 Shur I, Marom R, Lokiec F, Socher R, Benayahu D: Identification of cultured progenitor cells from human marrow stroma J Cell Biochem 2002, 87:51-57...

Ngày tải lên: 09/08/2014, 01:23

11 346 0
Báo cáo y học: "IFN-gamma regulation of ICAM-1 receptors in bronchial epithelial cells: soluble ICAM–1 release inhibits human rhinovirus infectio" pptx

Báo cáo y học: "IFN-gamma regulation of ICAM-1 receptors in bronchial epithelial cells: soluble ICAM–1 release inhibits human rhinovirus infectio" pptx

... protease inhibitors Methods Epithelial cell cultures and viral stocks Commercially available normal human bronchial epithelial cells (NHBE) (three separate sources) were obtained from Clonetics Corporation ... viral titres from infected cell cultures irrespective of IFN-γ pre-treatment Significantly, viral titres from HRV-1b infected cells were less than those observed from HRV-14 infected cells at and ... IFN-γ treatment of NHBE cells To determine effect of the Th-1 cytokine, IFN-γ, on expression of ICAM-1 isoforms in airway epithelial cells, medium was removed from cell cultures containing 70–...

Ngày tải lên: 11/08/2014, 08:22

16 288 0
Báo cáo y học: " Mometasone and desloratadine additive effect on eosinophil survival and cytokine secretion from epithelial cells" docx

Báo cáo y học: " Mometasone and desloratadine additive effect on eosinophil survival and cytokine secretion from epithelial cells" docx

... intercellular adhesion molecule (sICAM)-1 secretion from both NM and NP epithelial cell cultures as well as on eosinophil survival primed by secretions from both NM and NP cultured epithelial cells ... days After cell culture, the percentage of epithelial cell purity was 100% for both NM and NP cultures Generation of Human Epithelial Conditioned Media (HECM) When epithelial cell cultures reached ... production and secretion, not only in epithelial cells but also in other cell types On this regard, DL decreased IL-6 and IL-8 secretion from basophilic cells (KU812) and human mast cell line (HMC-1)...

Ngày tải lên: 12/08/2014, 13:22

9 251 0
Báo cáo y học: " Differentiated transplant derived airway epithelial cell cytokine secretion is not regulated by cyclosporine" pdf

Báo cáo y học: " Differentiated transplant derived airway epithelial cell cytokine secretion is not regulated by cyclosporine" pdf

... basal cells, Mucin 5AC (clone C-20, Santa Cruz Biotechnology, Santa Cruz CA) binding goblet cells and b-tubulin (catalogue # ab6046, Abcam Inc., Cambridge, MA) marking ciliated cells Epithelial cell ... concentrations represented secretion from cells demonstrated less than 1% labeling in cells maintained in ALI cultures for wk Double staining techniques demonstrated that cells that labeled for vimentin ... Interleukin-1b was selected as a stimulus to examine epithelial cell cytokine secretion as it elicits secretion of both IL-8 [19,20] and IL-6 [21,22] from cultured AEC Experimental arms consisted of...

Ngày tải lên: 12/08/2014, 13:22

9 389 0
Báo cáo y học: " Proinflammatory cytokine responses induced by influenza A (H5N1) viruses in primary human alveolar and bronchial epithelial cells" ppt

Báo cáo y học: " Proinflammatory cytokine responses induced by influenza A (H5N1) viruses in primary human alveolar and bronchial epithelial cells" ppt

... induction profile of primary human bronchial epithelial cells The cytokine and chemokine profiles induced by H1N1, H5N1/97 and H5N1/04 viruses in primary human bronchial epithelial cells were similarly ... identity of the cells in culture as human bronchial epithelial cells was confirmed by thin section electron microscopy Secretion of cytokine proteins from bronchial and alveolar epithelial cells To ... 2005, 6:135 Figure enza viruses Infection of human bronchial epithelial cells with human influInfection of human bronchial epithelial cells with human influenza viruses (A) The influenza M-gene...

Ngày tải lên: 12/08/2014, 18:20

13 214 0
w