Ngày tải lên: 07/09/2013, 13:48
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative ability/neg. ... exophoric anaphoric exophoric anaphoric anaphoric anaphoric exophoric anaphoric exophoric anaphoric anaphoric anaphoric anaphoric exophoric anaphoric anaphoric anaphoric anaphoric...
Ngày tải lên: 12/02/2014, 20:20
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... Gln 15 and the carbonyl oxygen atoms of Asp11 and Asn23 (Fig. 3) in an arrangement similar to what is observed in VPRK. Both PRK and VPRK have calcium bound at Ca3. SPRK also has an aspar- tic acid ... 1022–10 25. 39 Perrakis A, Harkiolaki M, Wilson KS & Lamzin VS (2001) ARP ⁄ wARP and molecular replacement. Acta Crystallogr Sect D Biol Crystallogr 57 , 14 45 1 450 . 40 Jones TA, Zou JY, Cowan SW & Kjeldgaard ... subtilases is capable of accommodating at least six amino acid residues (P4P2Â; notation according to Schechter and Berger [14]) of a polypeptide substrate or inhibitor [ 15] , and both main chain and...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... Alteromonas haloplanctis a- amylase give insights into cold adaptation at a molecular level. Structure 6, 150 3– 151 6. 9 Leiros I, Moe E, Lanes O, Smalas AO & Willassen NP (2003) The structure of uracil–DNA ... uracil–DNA glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features. Acta Crystallogr Sect D 59 , 1 357 –13 65. 10 Aghajari N, Van Petegem F, Villeret V, Chessa JP, Gerday C, Haser ... Stability and structural analysis of alpha-amylase from the antarctic psychrophile Alteromonas haloplanctis A2 3. Eur J Biochem 222, 441– 447. 51 Almog O, Gonzalez A, Klein D, Greenblatt HM, Braun S &...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Hexameric ring structure of a thermophilic archaeon NADH oxidase that produces predominantly H2O pot
... Significantly, this structural feature of NOXtp is highly similar to that of valosine-containing protein-like ATPase from Th. acidophilum, an archaeal member of the AAA family (ATPases associated ... the utilization of oxygen by Desulfovibrio gigas. Eur J Bio- chem 216, 443–448. 32 Sakuraba H, Takamatsu Y, Satomura T, Kawakami R & Ohshima T (2001) Purification, characterization, and application of a ... primer, 5 -CCG CAG GTT CCG GCG ATA GAG GGC GCC CAC CTG GAA GGA GTA TTC ACA GCA- 3Â; and C12 2A reverse primer, 5 -TGC TGT GAA TAC TCC TTC CAG GTG GGC GCC CTC TAT CGC CGG AAC CTG CGG-3Â. The PCR was...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx
... 242–2 45. 24 Maeda T, Takekawa M & Saito H (19 95) Activation of yeast PBS2 MAPKK by MAPKKKs or by binding of an SH3-containing osmosensor. Science 269, 55 4 55 8. 25 Posas F, Wurgler-Murphy SM, Maeda ... cerevisiae MAP kinase cascades typically composed of three tiers of protein kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic ... and Kholodenko et al. [19]. Among them, two recent remark- able developments are that of Kholodenko et al. [14] based on stationary experimental data, and that of Sontag et al. [ 15] based on time-series...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Crystal structure of a glycoside hydrolase family 6 enzyme, CcCel6C, a cellulase constitutively produced by Coprinopsis cinerea pot
... HinCel 6A and CcCel6C (Fig. 2) indicated that Asp 150 and Asp334 of CcCel6C are the potential catalytic residues and could act as a proton donor and a base, respectively. Another aspar- tic acid ... Igarashi 3 , Masahiro Samejima 3 , Kiyoharu Fukuda 1 , Atsushi Nishikawa 2 and Takashi Tonozuka 2 1 Department of Environmental and Natural Resource Science, Tokyo University of Agriculture and ... et al. 153 6 FEBS Journal 277 (2010) 153 2– 154 2 ª 2010 The Authors Journal compilation ª 2010 FEBS crystal structure of a cellulase was reported; it was a catalytic domain of Hypocrea jecorina...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Solution structure of 2¢,5¢ d(G4C4) Relevance to topological restrictions and nature’s choice of phosphodiester links docx
... links Bernard J. Premraj 1 , Swaminathan Raja 1 , Neel S. Bhavesh 2 , Ke Shi 3 , Ramakrishna V. Hosur 2 , Muttaiya Sundaralingam 3 and Narayanarao Yathindra 1 1 Department of Crystallography and Biophysics, ... J., Den Hartog, J .A. J., Van Boom, J.H. & Altona, C. (1981) Conformational analysis of the nucleotides A2 Â -5 A, A2 Â -5 - A2 Â -5 AandA2Â -5 U from nuclear magnetic resonance and circular dichroism ... considered for detailed discussion. Calculated values of X-displacement and slide for the base pairs in AFI are given in Table 5 . Average values of X-displacement and slide of GC base p airs at the GG...
Ngày tải lên: 16/03/2014, 18:20
hydrothermal synthesis and crystal structure of a novel one - dimensional tritungstate
... organicrinorganic hybrid materials due to their applications in catalysis, sorption, energy storage, molecular electronics, optical ma- wx terials and ceramics 1–4 . A promising synthetic route takes advantage of a ... novel wx porous and low-dimensional materials 5 7 . Typical ex- amples include coorperative assembly of organic wx aminesrtransition metal oxides involving iron 8,9 , cobalt wx wx w x 10 , vanadium 11 and ... low-temperature soft approach, hy- drothermal method, and the structure- directing function of organoamines. Recent developments in this area have proven its viability for the successful preparation of...
Ngày tải lên: 19/03/2014, 16:48
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx
... statistical quantity for assessing the accuracy of crystal structures. Nature 355 , 472–4 75. 49 Cruickshank DW (1999) Remarks about protein structure precision. Acta Crystallogr 55 , 58 3–601. 50 Read ... mature a bacterial class I c-type cytochrome, Paracoccus denitrif- icans cytochrome c 55 0 [33]. Moreover, many taxa that have heme lyase apparently have separate heme lyases for the maturation of ... glycerol-3- phosphate dehydrogenase of Trypanosomatidae and the glycosomal redox balance of insect stages of Trypanoso- ma brucei and Leishmania spp. Mol Biochem Parasitol 149, 155 –169. 16 van Hellemond...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx
... kinetic parameters were determined at various concen- trations of the substrate, tamarind seed xyloglucan (Dainip- pon Sumitomo Pharma, Osaka, Japan), in 50 mm sodium acetate buffer (pH 5. 5) at 45 °C ... at both ends. In the case of Xgh7 4A, the active cleft is open. Although a precise anal- ysis of the mode of action of Xgh7 4A has not been performed, Xgh7 4A appears to be an endoglucanase because ... used as a search model. The cns program [19] was used for refinement against the 20–2 .5 A ˚ intensity data. A ran- domly selected portion of the diffraction data (5. 0%) was used to calculate the...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx
... 15 379 ASA apolar (A ˚ 2 ) 8248 8931 857 2 9 059 ASA polar (A ˚ 2 ) 58 44 6949 59 90 6320 Formal global charge –1 –3 1 2 Theoretical pI b 6 .5 7 8 .5 9 a Following CLUSTALW program. b Calculated from ... 3 Glu2 45 Lys181 Glu236–His240 Glu272–Arg148 3 Asp 85 Arg88 Asp73–Lys 75 Glu310–Arg186 11 Glu5–His39 Glu1 95 His186 Glu1 95 His198 Glu 358 –His 355 Asp76–Arg80 Glu82–Arg177 Asp108–Arg1 05 Asp1 85 Lys183 Glu196–Arg210 Glu300–Arg1 05 Glu272–Arg148 Asp103–Arg107 Asp 251 –Lys 258 Asp283–His271 Glu366–His370 Glu287–Arg163 No. ... accessible surface of nonpolar side chains and of the accessible charged sur- faces are observed in cold-adapted enzymes. Polar and apolar accessible surface areas were therefore also calculated, but...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: The crystal structure of a hyperthermostable subfamily II isocitrate dehydrogenase from Thermotoga maritima pdf
... D36N-1 5- CATCCTTCCCTATCTC AACATCCAGCTGGTTTACT-3 D341N-1 5- AAGGGGAGAACTC AACGGAACACCGGAGG-3 D389N 5- CACTCTCGAAGAGTTCATA AACGAAGTGAAGAAGAATCTC-3 5- GAGATTCTTCTTCACTTCGT TTATGAACTCTTCGAGAGTG-3 M. Karlstro ă m ... 5 -CCTGGAGAAATCGATCA TGAGCTTCGCTCAGTCGTG-3’ 5 -CACGACTGAGCGAAGCT CATGATCGATTTCTCCAGG-3’ F205M 5 -AAAAGGTCGACATCTGG ATGGCGACGAAAGACACGATC-3’ 5 -GATCGTGTCTTTCGTCGC CATCCAGATGTCGACCTTTT-3’ D36N + D341N D36N-1 5- CATCCTTCCCTATCTC AACATCCAGCTGGTTTACT-3 D341N-1 5- AAGGGGAGAACTC AACGGAACACCGGAGG-3 D389N ... conformations with 50 % occupancy each (Lys A4 8, Lys A6 2, Glu A8 1, Lys A8 4, Arg A1 09, Lys A1 83, Lys A2 20, Asn A2 40, Glu A3 00, Arg A3 07, Arg A3 08, Arg A3 35, Glu A3 48, Glu A B C Fig. 2. (A) Ribbon...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt
... respectively, by means of standard Lineweaver–Burk analysis of initial rate kinetics. Fitting of the experimental data required as input data the initial concentrations of BApNA, enzyme and inhibitor, ... Statistics for the total amount of experimental data are reported in Table 3. A simulated annealing (SA) procedure was used starting from a randomly generated linear polypeptide chain. The actual ... LCI- 1.7 and a Discussion of Atypical Binding Sites of Bow- man-Birk Inhibitors. J Agric Food Chem 52 , 4219–4226. 23 Catalano M, Ragona L, Molinari H, Tava A & Zetta L (2003) Anticarcinogenic...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt
... (GenBank: AAA19802), T. reesei (GenBank CAA4 959 6), A. niger (GenBank AAF04491), H. grisea (GenBank AAD11942) and A. acule- atus (GenBank BAA 251 83) gave sequence identity values of 65% , 64%, 73%, 51 % ... outer and inner RACE primers were as follows: outer 5 -RACE primer CATGCGGTAAGGGTTGAAGTCACA-3Â; inner 5 -RACE primer 5 -GTTTGCTTCCCAGACATC CATC-3Â; outer 3Â-RACE primer 5 -ATGCTGTGGTTGG ATTCCGACTAC-3Â; ... GenBank AAA19802), and Tricho- derma reesei (T.reesei; GenBank CAA4 959 6). Residues in white against a black background are amino acids that are identical or have a conserved substitution in all...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Crystal structure of a staphylokinase variant A model for reduced antigenicity pptx
... pH 7 .5 8 .5] . Data collection X-ray d iffraction data were collected using an i n-house Rigaku rotating anode X-ray generator with a MAR Research MAR3 45 image plat e detector. The radiation wavelength ... designated as aa, h eadtail, and b±b.Thea a dimer h as a diad 3 and is characterized as helix-helix packing between the two monomers, as shown in Fig. 2A. The head±tail dimer is formed by a crystallographic ... 276, 307±326. 26. Navaza, J. (1994) AMORE: an automated package for molecular replacemen t. Acta Crystallogr. A5 0 , 157 ±163. 27. Brunger, A. (1993) X-PLOR, V ersion 3.1. A System for X-Ray Crystallography and...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khoa học: Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand pot
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Inhibitor-mediated stabilization of the conformational structure of a histone deacetylase-like amidohydrolase pptx
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
Ngày tải lên: 31/03/2014, 07:20