strategy with a synthetic gnrh based vaccine candidate

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Ngày tải lên : 23/03/2014, 09:21

... graded transactivation potential Nucleic Acids Res 25, 2723–2729 13 Akagi K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation ... CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, transfection, and ﬂow ... and with a GAPDH probe (cf Fig 2) Relative background transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed...

8
331
0

Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf

Ngày tải lên : 07/08/2014, 20:24

... Gene amplified size (bp) 1,701 1,795 1,719 1,779 Primer sequence 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG ... fusion and hemagglutininNeuraminidase antigens Avian Dis 1996, 40, 770-777 Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida N, Saeki S, Kamogawa K Antibody response to Newcastle disease ... Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the Newcastle disease virus (NDV) fusion glycoprotein and vaccination against NDV challenge with a recombinant baculovirus...

8
315
0

Báo cáo y học: " Initial experience with a synthetic sealant PleuraSeal™ after pulmonary resections: a prospective study with retrospective case matched controls" docx

Ngày tải lên : 10/08/2014, 09:22

... lung sealant an intraoperative air leak test during lung inflation was carried out to evaluate the location and grade of air leaks as described above In the event of a grade air leak additional suture ... to access by standard suturing or fleece-bond sealants, PleuraSeal™ as a liquid sealant is ideal to seal air leaks in this interlobar space with its many anatomical variations As part of this Protocol ... efficacy of the trial sealant as compared with standard surgical treatment for sustained sealing of postoperative air leakage following pulmonary resections It enables an immediate and safe air...

9
214
0

Báo cáo khoa hoc:" Light triggered detection of aminophenyl phosphate with a quantum dot based enzyme electrode" ppsx

Ngày tải lên : 11/08/2014, 08:20

... was measured again Also hereby illumination was switched on and off several times with a mechanical shutter For the next measurement the cell was again rinsed twice, an increasing amount of 4AP ... film Analytical Chemistry 1997, 69:4688-4694 Nistor C, Emneus J: An enzyme flow immunoassay using alkaline phosphatase as the label and a tyrosinase biosensor as the label detector Analytical Communications ... Communications 1998, 35:417-419 Kreuzer MP, O’Sullivan CK, Guilbault GG: Alkaline phosphatase as a label for immunoassay using amperometric detection with a variety of substrates and an optimal buffer...

10
239
0

báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps

Ngày tải lên : 11/08/2014, 12:21

... Cancer, Ovarian Cancer and Leukemia SPOREs, and by a 2009 Seena Magowitz Pancreatic Cancer Action Network AACR Pilot Grant Author details RNA interference and non-coding RNA Center and the Department ... diverse applications in various clinical and laboratory environments Yet applying these RNA -based regulatory systems in clinical practice may still require more time In addition, there are many other ... information GAC received his MD and PhD at Carol Davila University of Medicine in Bucharest, Romania After working on cytogenetics as an undergraduate student with Dragos Stefanescu in Bucharest, he...

3
239
0

Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot

Ngày tải lên : 12/08/2014, 04:21

... (C): arrow (plasma membrane), large arrow head (trans-Golgi membrane), small arrow heads (immature viruses); (D): arrow (plasma membrane), large arrow heads (Golgi apparatus), small arrow (cell associated ... Nemeckova S, Hainz P, Otahal P, Gabriel P, Sroller V, Kutinova L: Early gene expression of vaccinia virus strains replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) ... (cell associated vesicle); (E): arrow (plasma membrane), arrow heads (CEVs); (F): arrow (plasma membrane), large arrow heads (EEVs), small arrow head (plasma membrane projection) The same results...

13
377
0

Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps

Ngày tải lên : 12/08/2014, 04:21

... (C): arrow (plasma membrane), large arrow head (trans-Golgi membrane), small arrow heads (immature viruses); (D): arrow (plasma membrane), large arrow heads (Golgi apparatus), small arrow (cell associated ... Nemeckova S, Hainz P, Otahal P, Gabriel P, Sroller V, Kutinova L: Early gene expression of vaccinia virus strains replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) ... (cell associated vesicle); (E): arrow (plasma membrane), arrow heads (CEVs); (F): arrow (plasma membrane), large arrow heads (EEVs), small arrow head (plasma membrane projection) The same results...

13
294
0

Báo cáo y học: " Simulating non-small cell lung cancer with a multiscale agent-based model" doc

Ngày tải lên : 13/08/2014, 16:21

... Yumoto N, Ichikawa M, Kim JH, Saito K, Saeki M, Shirouzu M, Yokoyama S, Konagaya A: A computational model on the modulation of mitogen-activated protein kinase (MAPK) and Akt pathways in heregulininduced ... metastatic variant of a human non-small-cell lung cancer cell line Br J Cancer 1996, 74:1776-1782 Kurachi H, Morishige K, Amemiya K, Adachi H, Hirota K, Miyake A, Tanizawa O: Importance of transforming ... plotted are the absolute change of PLCγ, rate of change of PLCγ, and rate of change of ERK Note that the number of proliferations is decreasing gradually and finally disappears at a phase transition...

14
412
0

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Ngày tải lên : 18/06/2014, 18:20

... Tamura S, Funato H, Hirabayashi Y, Kikuta K, Suzuki Y, Nagamine T, Aizawa C, Nakagawa M, Kurata T: Functional role of respiratory tract haemagglutinin-specific IgA antibodies in protection against ... influenza Vaccine 1990, 8:479-485 Tamura SI, Asanuma H, Ito Y, Hirabayashi Y, Suzuki Y, Nagamine T, Aizawa C, Kurata T, Oya A: Superior cross-protective effect of nasal vaccination to subcutaneous ... Matsuo K, Yoshikawa T, Asanuma H, Iwasaki T, Hagiwara Y, Chen Z, Kadowaki SE, Tsujimoto H, Kurata T, Tamura SI: Induction of innate immunity by nasal influenza vaccine administered in combination...

14
515
0

Báo cáo y học: " Reservoir cells no longer detectable after a heterologous SHIV challenge with the synthetic HIV-1 Tat Oyi vaccine" doc

Ngày tải lên : 13/08/2014, 09:21

... (panel A) following SHIV challenge (SHIV-BX08) Oyi Viral load of rhesus macaques vaccinated with Tatβ-gal Figure B) and control macaques vaccinated with Viral load of rhesus macaques vaccinated ... I) A heterologous SHIV-BX08 challenge carried out on seven macaques vaccinated with Tat Oyi/Montanide ISA720 and four control macaques vaccinated with β-galactosidase that were used also as control ... challenge The seven macaques vaccinated with Tat Oyi were included in a SHIV challenge assay called RIVAC sponsored by the ANRS The purpose of the RIVAC assay was to compare ten vaccine approaches...

10
310
0

Báo cáo sinh học: " A strategy of tumor treatment in mice with doxorubicin-cyclophosphamide combination based on dendritic cell activation by human double-stranded DNA preparation" doc

Ngày tải lên : 14/08/2014, 19:22

... DC maturation as the standard inducer TNF -a The obtained mature DCs loaded with antigen during maturation were used in the comparative test A marked antitumor effect was observed after vaccination ... preparation Human DNA preparation was isolated from the placentas of healthy women using a phenol-free method It was fragmented in an ultrasonic disintegrator at a frequency of 22 kHz to obtain a ... of DNA fragments with a size 200-6,000 bp The human DNA was a pharmacopeian preparation “Panagen” (Registration certificate Medical Drugs of Russia No 004429/08 of 09.06.2008) This preparation...

10
254
0

Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future

Ngày tải lên : 05/09/2013, 10:17

... plants Microalgae cultivation and reclamation Wastewater Artificial wetland Disinfection Primary settled sludge Microalgal cells Organics in high concentration Oil extraction Environmental and ... domestic wastewater reclamation coupled with biofuel/biomass production based on microalgae considers wastewater as a kind of resource instead of just waste, and shifts the wastewater treatment ... grew best and accumulated the highest lipid content in microalgal cells Algae isolated from wastewater treatment plant sites or real water bodies can usually adapt to culture conditions and grow...

9
762
0

Tài liệu Báo cáo khoa học: "Generating with a Grammar Based on Tree Descriptions: a Constraint-Based Approach" pptx

Ngày tải lên : 20/02/2014, 18:20

... instantiated A free variable is instantiated as follows: each free variable labels a syntactic node variable and is unied with the label of any node variable identied with For the purpose of this paper, ... is a model in which each negaS tive node variable is identied with exactly one positive node variable, each positive node variable with exactly one negative node variable and neutral node variables ... neutral node variable is a variable that may not be identied with any other node variable Formally, polarities are used to dene the class of saturated modfor a tree description els A saturated model...

8
397
0

Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low afﬁnity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Ngày tải lên : 21/02/2014, 03:20

... ﬁrst pair was X289 (5¢ TgTgCTACTTgCC CTggAA 3¢) and X191 The second pair was X133 (5¢ TCC AgAAAAgATCgCAA gATg 3¢) [35] and X300 (5¢ AgAgC CAAgCTTTTACT ATCggTT 3¢) The PCR products were fractionated ... before and after application of toxins tested Electrical signals after ampliﬁcation were collected and digitized, at a sampling rate of 25 kHz, with the aid of a computer equipped with an analogue-to-digital ... analogue-to-digital interface board (DT2821, Data Translation, Marlboro, USA) Endplate potentials and miniature endplate potentials were analysed individually for amplitude and time course RESULTS Cloning and...

10
395
0

Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

Ngày tải lên : 07/03/2014, 06:20

... and (D) annexin A1 The migration positions of molecular mass standards and protein loading amounts are indicated IEF ⁄ SDS ⁄ PAGE -based investigation, a commercially available colloidal Coomassie ... (release 48.8) with fixed carbamidomethyl modification of cysteine residues, variable oxidation of methionine and variable deamidation of asparagine and glutamine Parent and fragment mass tolerances ... ending with a lysine FEBS Journal 275 (2008) 4490–4509 ª 2008 The Authors Journal compilation ª 2008 FEBS Protein identificationb ALDOA_HUMAN ANXA1_RABIT CAPG_HUMAN CLUS_CANFA CLUS_CANFA CLUS_CANFA...

20
506
0

Báo cáo khoa học: "Chinese Segmentation with a Word-Based Perceptron Algorithm" docx

Ngày tải lên : 08/03/2014, 02:21

... bigram w1 w2 single-character word w a word starting with character c and having length l a word ending with character c and having length l space-separated characters c1 and c2 character bigram ... each candidate in the source agenda and puts the generated candidates onto the target agenda After each character is processed, the items in the target agenda are copied to the source agenda, ... source agenda, and then the target agenda is cleaned, so that the newly generated candidates can be combined with the next incoming character to generate new candidates After the last character is...

8
380
0

Báo cáo khoa học: "Lexicon acquisition with a large-coverage unification-based grammar" pot

Ngày tải lên : 17/03/2014, 22:20

... the status of the features Barg and Walther (1998) talk about generalisable and revisable information The former are values that are too specific (e.g case), while the latter are values that should ... not with a grammar of a similar coverage We have described a way how the information concerning unknown words can be restricted in a grammatically sound way, by the definition of lexical types and ... — and can therefore be realised by a type — the fact that it is a plural will restrict it further Evaluation There are two aspects that are relevant to be measured: the quality of the newly acquired...

4
251
0

Báo cáo khoa học: "LEARNING TRANSLATION SKILLS WITH A KNOWLEDGE-BASED FRENCH-ITALIAN CONJUNCTIONS IN CONTEXT" pdf

Ngày tải lên : 18/03/2014, 02:20

... languages E L I S A : A RATHER INTELLIGENT TUTOR OF FOREIGN LANGUAGE WORDS A The Purpose of ELISA ELISA teaches a student to disambiguate conjunctions in a foreign language by means of a dialogue ... available in the field of Foreign Language Teaching and usable on a large scale for Computer Assisted Learning II The Presentation P h a s e Notice that "concepts" are defined pragmatically i.e ... a proof of the potential power of AI representations in educational settings and in projects of natural language translation Practically, our program is one of the few Intelligent Systems available...

6
349
0

Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx

Ngày tải lên : 23/03/2014, 13:20

... Oehlke et al (Eur J Biochem 271) Table Sequences of the PNA derivatives studied Compound Sequence MAP I KLALKLALKALKAALKLA-NH2 Fluos-GGAGCAGGAAAG-Lys (antisense) Fluos-GGAGCAGGAAAG-MAP (antisense) ... suitability of a conjugate of the synthetic CPP MAP (KLALKLALKALKAALKLANH2) [9,10] with a 12-mer peptide nucleic acid (5¢-GGAGCAGGAAAG-3¢) directed against the mRNA of the nociceptin/orphanin ... external PNA solution Each bar represents the mean of three samples ± SEM Results Conjugation with MAP leads to an increased intracellular availability of PNA In order to examine the ability of MAP to...

7
325
0